Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 6—June 2010

Research

Astrovirus Encephalitis in Boy with X-linked Agammaglobulinemia

Phenix-Lan Quan, Thor A. Wagner, Thomas Briese, Troy R. Torgerson, Mady Hornig, Alla Tashmukhamedova, Cadhla Firth, Gustavo Palacios, Ada Baisre-De-Leon, Christopher D. Paddock, Stephen K. Hutchison, Michael Egholm, Sherif R. Zaki, James E. Goldman, Hans D. Ochs, and W. Ian LipkinComments to Author 
Author affiliations: Author affiliations: Columbia University, New York, New York, USA (P.-L. Quan, T. Briese, M. Hornig, A. Tashmukhamedova, G. Palacios, A. Baisre-De-Leon, J.E. Goldman, W.I. Lipkin); University of Washington, Seattle, Washington, USA (T.A. Wagner, T.R. Torgerson, H.D. Ochs); Seattle Children’s Hospital, Seattle (T.A. Wagner, T.R. Torgerson, H.D. Ochs); Pennsylvania State University, Pittsburgh, Pennsylvania, USA (C. Firth); Centers for Disease Control and Prevention, Atlanta, Georgia, USA (C.D. Paddock, S.R. Zaki); and 454 Life Sciences, Branford, Connecticut, USA (S.K. Hutchison, M. Egholm)

Main Article

Table 6

Primers used in cloning and sequencing the human astrovirus Puget Sound genome

Sequence (5′ → 3′) Position
TCATGGAGCGCTCATACAAG
GTGTAAGCGAAGCCAAAAGC 38–57
815–796
GATTGGGTTGAGGTTGATGC*
TCCAGTGGTGGCTTGATGTA 340–359
1797–1778
GAAGTGGGATGGTGGAGTTG
TCCAGAAATCCGATTCAACC 666–685
1314–1295
TGGAGCAGTTGTTGGTGAAA
TTCTCAAGGTCTATCTCCCTTTGT 1215–1234
1877–1854
TACATCAAGCCACCACTGGA*
TCCGCCTCTCTAAGCACTTC 1778–1797
2159–2140
TACATCAAGCCACCACTGGA
TTGGATTGACTCCCTCAAGC 1778–1797
2533–2514
ATCACCACAAGAGGCGTAGG*
CCAGTAACTGCTGATGGACCAACAA 2039–2058
4649–4625
CGTGATTTGCAGGAATACCA
CCCATACGTGTCAGGGTTCT 2446–2465
3343–3324
TCTGGAGAGAGGCCTGATGT
TCTCTCTTGACCCACATCCC 3159–3178
3865–3846
CCTCTGGGCAAATATCCACA
TAGGGATATGCGGAAAACAGA 3625–3644
4671–4651
GTTTGTGGCGCTTGAAAAGT
TTGCGTGGAAGAAAGTGTTG 4583–4602
5365–5345
TTGTTGGTCCATCAGCAGTTACTGG*
AACTTTTGCAACCAAGCCAG 4 625–4649
5175–5156
CTGGCTTGGTTGCAAAAGTT
GAGTATTGTGCCCGCAAAGT 5156–5175
6041–6022
CGGCTACACCAGCCTACATT
CAGCACCATCAGACACATGG 5833–5852
6442–6423

*Primer pairs designed for amplification between ultra–high-throughput sequencing contiguous fragments (Figure 2); primer pairs without asterisk were applied for resequencing of the draft genome.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO