Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 6—June 2010

Research

Increase in Pilus Islet 2–encoded Pili among Streptococcus pneumoniae Isolates, Atlanta, Georgia, USA

Dorothea ZähnerComments to Author , Aditya Gudlavalleti, and David S. Stephens
Author affiliations: Emory University School of Medicine, Atlanta, Georgia, USA (D. Zähner, A. Gudlavalleti, D.S. Stephens); Department of Veterans Affairs Medical Center, Atlanta (D. Zähner, D.S. Stephens)

Main Article

Table 1

Primers used in this study of invasive Streptococcus pneumoniae isolates, Atlanta, Georgia, USA, 1994–2006*†

Region Primer Sequence (5′ → 3′)‡
Erm cassette erm_F gctctagaCGTTAGATTAATTCCTACCAGTGAC

erm_R
gctctagaCTCCATTCCCTTTAGTAACGTGTAAC
PI-2 pepT_F TAAGAAGCGGTCCAAGAGATTTGG
hemH_R AATAATGGGGCTCCAAAATCAAGC
sipA_up_F CTCTAGGAGGGATCTTCTTTATCATC
sipA_do_R CTACAGCCGTTGTTCGATTGTCC
PilA_del_3 gcaattgcccgggcctagCCTGTATAGGGATGGTTCCAAAAG
PilA_del_2 ctaggcccgggcaattgcGCTGGGGGCAGATGATG

Rlr_up_F
CTTCCACGAAGTTCTTTCAATGG
PI-1 Rlr_do_R GTCTTAGAATATCATGGTTTACGTGC
Rlr_srtC_F GGGGAAGATTATGCGACCTT
Rlr_srtD_R GCTTGGCTCTGCACGGTGCC

*PI, pilus islet.
†Not included are primers used for sequencing and multilocus sequence typing.
‡Lowercase letters represent bases added for mutagenesis; uppercase letters represent bases complementary to S. pneumoniae.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO