Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 6—June 2010

Letter

Laboratory Diagnosis of Lassa Fever, Liberia

Marcus Panning, Petra Emmerich, Stephan Ölschläger, Sergiusz Bojenko, Lamine Koivogui, Arthur Marx, Peter Clement Lugala, Stephan Günther, Daniel G. Bausch, and Christian DrostenComments to Author 
Author affiliations: Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany (M. Panning, P. Emmerich, S. Ölschläger, S. Günther, C. Drosten); United Nations Mission in Sierra Leone, Freetown, Sierra Leone (S. Bojenko); Program on Hemorrhagic Fevers, Conakry, Guinea (L. Koivogui); World Health Organization, Geneva, Switzerland (A. Marx); World Health Organization, Monrovia, Liberia (P.C. Lugala); Tulane University Health Sciences Center, New Orleans, Louisiana, USA (D.G. Bausch)

Main Article

Table

Laboratory results and primer sequences on 12 patients with Lassa fever, Liberia*†

Strain
designation‡ Deviations from sequence (5′ → 3′)‡
Original primers (6) Modified primers Cell culture Log10 RNA copies/mL Anti-LASV IgM titer‡ Anti-LASV IgG titer‡
TGCACAAAGAACAACAGTCATCATTATAT
129/05 ---T----A-----T-----C-------- + + 3.20 Neg <10
UN133 ---T----A-----T-----C-------- + + 3.99 Neg <10
121/1580 --T-----A-----------C--C----- + + 4.14 Neg <10
127/05 --------A-------------------- + + + 6.22 Neg <10
4094/05 --------A-----------------C-- + + + 4.53 Neg <10
Lib3800 --T-----------------C-------- + + + 4.90 160 5,120
Lib88 --T-----------------C—-C----- + + + 7.49 40 20
Lib90 --T-----------------C—-C----- + + + 5.17 Neg <10
295/06 --T-----------------C—-C----- + + + 5.41 80 640
383/06 --------------------C--C--C-- + + + 4.38 40 <10
120/06 --------A--------C--C-----C-- + + + 4.50 Neg <10
174/06 -----------TG-T--C--C--C--C-- + + + 5.02 320 640

*LASV, Lassa fever virus; Ig, immunoglobulin.
†Primers sequences are compared to that published by Demby et al. (6) (reverse primer binding sites). Virus isolation was done on Vero cells in a BioSafety level 4 laboratory. Serologic testing for anti-LASV IgM and IgG was performed by using the indirect immunofluorescent assay.
‡From reference strain AY628203, position 3092–3064 = reverse primer binding site in (6); note that the forward primer is not analyzed because it is located in the conserved stem-loop structure of LASV small segment RNA.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO