Volume 16, Number 6—June 2010
Letter
Laboratory Diagnosis of Lassa Fever, Liberia
Marcus Panning, Petra Emmerich, Stephan Ölschläger, Sergiusz Bojenko, Lamine Koivogui, Arthur Marx, Peter Clement Lugala, Stephan Günther, Daniel G. Bausch, and Christian Drosten
Table
Laboratory results and primer sequences on 12 patients with Lassa fever, Liberia*†
| Strain designation‡ | Deviations from sequence (5′ → 3′)‡ |
Original primers (6) | Modified primers | Cell culture | Log10 RNA copies/mL | Anti-LASV IgM titer‡ | Anti-LASV IgG titer‡ |
|---|---|---|---|---|---|---|---|
| TGCACAAAGAACAACAGTCATCATTATAT | |||||||
| 129/05 | ---T----A-----T-----C-------- | – | + | + | 3.20 | Neg | <10 |
| UN133 | ---T----A-----T-----C-------- | – | + | + | 3.99 | Neg | <10 |
| 121/1580 | --T-----A-----------C--C----- | – | + | + | 4.14 | Neg | <10 |
| 127/05 | --------A-------------------- | + | + | + | 6.22 | Neg | <10 |
| 4094/05 | --------A-----------------C-- | + | + | + | 4.53 | Neg | <10 |
| Lib3800 | --T-----------------C-------- | + | + | + | 4.90 | 160 | 5,120 |
| Lib88 | --T-----------------C—-C----- | + | + | + | 7.49 | 40 | 20 |
| Lib90 | --T-----------------C—-C----- | + | + | + | 5.17 | Neg | <10 |
| 295/06 | --T-----------------C—-C----- | + | + | + | 5.41 | 80 | 640 |
| 383/06 | --------------------C--C--C-- | + | + | + | 4.38 | 40 | <10 |
| 120/06 | --------A--------C--C-----C-- | + | + | + | 4.50 | Neg | <10 |
| 174/06 | -----------TG-T--C--C--C--C-- | + | + | + | 5.02 | 320 | 640 |
*LASV, Lassa fever virus; Ig, immunoglobulin.
†Primers sequences are compared to that published by Demby et al. (6) (reverse primer binding sites). Virus isolation was done on Vero cells in a BioSafety level 4 laboratory. Serologic testing for anti-LASV IgM and IgG was performed by using the indirect immunofluorescent assay.
‡From reference strain AY628203, position 3092–3064 = reverse primer binding site in (6); note that the forward primer is not analyzed because it is located in the conserved stem-loop structure of LASV small segment RNA.
