Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 9—September 2010

Dispatch

Analysis of Avian Hepatitis E Virus from Chickens, China

Qin Zhao, En Min Zhou1Comments to Author , Shi Wei Dong, Hong Kai Qiu, Lu Zhang, Shou Bin Hu, Fei Fei Zhao, Shi Jin Jiang, and Ya Ni Sun
Author affiliations: Author affiliation: Shandong Agricultural University, Shandong, People’s Republic of China

Main Article

Table 1

Primers used for PCR amplification of the China avian hepatitis E virus genome

Primer* Sequence, 5′ → 3′† Position, nt‡
F1-1 CCATGCCAGGGTAAGAATG 9–27
R1-1 AAAACAGCAAGGACCTCC 1872–1889
F1-2 CCAGGGTAAGAATGGACG 14–31
R1-2 TAATCCAGGTGGCGAGC 1308–1324
F2-1 CACTGTGGGTAACATTGTGGC 1071–1091
R2-1 GTTCGACTGCTTAGCCACCTG 2935–2955
F2-2 AGGCGGAACACGCACAGCA 1214–1232
R2-2 TCGTCCACAATGACCCTGC 2624–2642
F3-1 GGCTGTGTGGCATGTTCCA 1985–2003
R3-1 GGTAAAGAGCCACCATCCAAT 4010–4030
F3-2 CCGTGATGGTGACTTGTTGGTTGT 2262–2285
R3-2 GGCACATCTCCGCATACTC 3586–3604
F4-1 CCCTTCAACATTGGAGTATGC 3573–3593
R4-1 ATCTGGTACCGTGCGAGT 4899–4916
F4-2 ACATTGGAGTATGCGGAGATG 3580–3600
R4-2 TTGAGCGCTCCACTGGGCT 4820–4838
F5 GACAATTCAGCCCAGTGGA G 4809–4828
AUAP§ GACTCGAGTCGACATCG A Nonviral
AP§ GACTCGAGTCGACATCGA (T)17 Nonviral

*Primers F1-1 to R1-2, F2-1 to R2-2, F3-1 to R3-2, and F4-1 to R4-2 were used to amplify the first, second, third, and fourth fragment of the near-complete avian hepatitis E virus (HEV) genome. Primers F5, amplification primer (AUAP), and adapter primer (AP) were used to amplify the extreme 3′ genomic sequence. Primers R1-1, R2-1, R3-1, R4-1, and AP are also reverse transcription primers.
†Sequences of primers were designed according to the sequences of 4 other known avian HEV strains.
‡Positions of primers located in the complete genome are shown according to the Europe avian HEV isolate.
§Commercial primer (Invitrogen, Carlsbad, CA, USA) of nonviral origin.

Main Article

1Current affiliation: Northwest A&F University, Yangling, People’s Republic of China.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO