Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 1—January 2011

Dispatch

New Delhi Metallo-β-Lactamase in Klebsiella pneumoniae and Escherichia coli, Canada

Michael R. MulveyComments to Author , Jennifer M. Grant, Katherine Plewes, Diane Roscoe, and David A. Boyd
Author affiliations: Author affiliations: Public Health Agency of Canada, Winnipeg, Manitoba, Canada (M.R. Mulvey, D.A. Boyd); Vancouver General Hospital, Vancouver, British Columbia, Canada (J.M. Grant, K. Plewes, D. Roscoe)

Main Article

Table 1

Primers used in study of New Delhi metallo-β-lactamase in Klebsiella pneumoniae and Escherichia coli, Canada, 2010

Name Sequence, 5′ → 3′* Product size, bp
SHV-UP CGCCGGGTTATTCTTATTTGTCGC 1,016
SHV-LO TCTTTCCGATGCCGCCGCCAGTCA
TEM-G TTGCTCACCCAGAAACGCTGGTG 708
TEM-H TACGATACGGGAGGGCTTACC
CTX-U1 ATGTGCAGYACCAGTAARGTKATGGC 593
CTX-U2 TGGGTRAARTARGTSACCAGAAYCAGCGG
OXA1-F CGCAAATGGCACCAGATTCAAC 464
OXA1-R TCCTGCACCAGTTTTCCCATACAG
CMY2-A TGATGCAGGAGCAGGCTATTCC 323
CMY2-B CTAACGTCATCGGGGATCTGC
KPC1 ATGTCACTGTATCGCCGTC 863
KPC2 AATCCCTCGAGCGCGAGT
VIM1 GTTTGGTCGCATATCGCAAC 382
VIM2 AATGCGCAGCACCAGGATAGAA
IMP1 CCWGATTTAAAAATYGARAAGCTTG 522
IMP2 TGGCCAHGCTTCWAHATTTGCRTC
NDM-F GGTGCATGCCCGGTGAAATC 660
NDM-R ATGCTGGCCTTGGGGAACG
NDM-A CACCTCATGTTTGAATTCGCC 984
NDM-B CTCTGTCACATCGAAATCGC

*H is A, C, or T; K is G or T; R is A or G; S is G or C; and W is A or T.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO