Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 2—February 2011

Dispatch

Oseltamivir-Resistant Pandemic (H1N1) 2009 Virus, Mexico

José Ernesto Ramirez-Gonzalez, Elizabeth Gonzalez-Duran, Patricia Alcantara-Perez, Claudia Wong-Arambula, Hiram Olivera-Diaz, Iliana Cortez-Ortiz, Gisela Barrera-Badillo, Ha Nguyen, Larisa Gubareva, Irma Lopez-Martinez, Jose Alberto Díaz-Quiñonez, Miguel Angel Lezana-Fernández, Hugo Lopez Gatell-Ramírez, Jose Angel Cordova Villalobos, Mauricio Hernández-Avila, and Celia Alpuche-ArandaComments to Author 
Author affiliations: Author affiliations: Instituto de Diagnóstico y Referencia Epidemiológicos, Mexico City, Mexico (J.E. Ramirez-Gonzalez, E. Gonzalez-Duran, P. Alcantara-Perez, C. Wong-Arambula, H. Olivera-Diaz, I. Cortez-Ortiz, G. Barrera-Badillo, I. Lopez-Martinez, J.A. Díaz-Quiñonez, M.A. Lezana-Fernández, H.L. Gatell-Ramírez, J.A.; Cordova Villalobos, M. Hernández-Avila, C. Alpuche-Aranda); Secretaría de Salud, Mexico City (J.E. Ramirez-Gonzalez, E. Gonzalez-Duran, P. Alcantara-Perez, C. Wong-Arambula, H. Olivera-Diaz, I. Cortez-Ortiz, G. Barrera-Badillo, I. Lopez-Martinez, J.A. Díaz-Quiñonez, M.A. Lezana-Fernández, H.L. Gatell-Ramírez, J.A. Cordova Villalobos, M. Hernández-Avila, C. Alpuche-Aranda); Centers for Disease Control and Prevention, Atlanta, Georgia, USA (H. Nguyen, L. Gubareva)

Main Article

Table 2

Primer sets used in reverse transcription–PCR and Sanger sequencing of isolates for pandemic (H1N1) 2009, Mexico, May 2009–April 2010*

Primer Sequence, 5′ → 3′ Target/position, nt
FLUAN1–721F GTAATGACCGATGGACCAAG NA/721
FLUAN1–924R CTGGTTGAAAGACACCCAC NA/924
FLUAN1–904R GTCGATTCGAGCCATGCCAG NA/904
MBTuni-12† ACGCGTGATCAGCAAAAGCAGG NA/5′ UTR
MBTuni-13† ACGCGTGATCAGTAGAAACAAGG NA/3′ UTR

*NA, neuraminidase; UTR, untranslated region.
†Primer sets previously published in 2009 (11).

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO