Skip directly to site content Skip directly to page options Skip directly to A-Z link Skip directly to A-Z link Skip directly to A-Z link
Volume 17, Number 2—February 2011
Dispatch

Oseltamivir-Resistant Pandemic (H1N1) 2009 Virus, Mexico

José Ernesto Ramirez-Gonzalez, Elizabeth Gonzalez-Duran, Patricia Alcantara-Perez, Claudia Wong-Arambula, Hiram Olivera-Diaz, Iliana Cortez-Ortiz, Gisela Barrera-Badillo, Ha T. Nguyen, Larisa Gubareva, Irma Lopez-Martinez, Jose Alberto Díaz-Quiñonez, Miguel Angel Lezana-Fernández, Hugo Lopez Gatell-Ramírez, Jose Angel Cordova Villalobos, Mauricio Hernández-Avila, and Celia M. Alpuche-ArandaComments to Author 
Author affiliations: Author affiliations: Instituto de Diagnóstico y Referencia Epidemiológicos, Mexico City, Mexico (J.E. Ramirez-Gonzalez, E. Gonzalez-Duran, P. Alcantara-Perez, C. Wong-Arambula, H. Olivera-Diaz, I. Cortez-Ortiz, G. Barrera-Badillo, I. Lopez-Martinez, J.A. Díaz-Quiñonez, M.A. Lezana-Fernández, H.L. Gatell-Ramírez, J.A.; Cordova Villalobos, M. Hernández-Avila, C. Alpuche-Aranda); Secretaría de Salud, Mexico City (J.E. Ramirez-Gonzalez, E. Gonzalez-Duran, P. Alcantara-Perez, C. Wong-Arambula, H. Olivera-Diaz, I. Cortez-Ortiz, G. Barrera-Badillo, I. Lopez-Martinez, J.A. Díaz-Quiñonez, M.A. Lezana-Fernández, H.L. Gatell-Ramírez, J.A. Cordova Villalobos, M. Hernández-Avila, C. Alpuche-Aranda); Centers for Disease Control and Prevention, Atlanta, Georgia, USA (H. Nguyen, L. Gubareva)

Main Article

Table 2

Primer sets used in reverse transcription–PCR and Sanger sequencing of isolates for pandemic (H1N1) 2009, Mexico, May 2009–April 2010*

Primer Sequence, 5′ → 3′ Target/position, nt
FLUAN1–721F GTAATGACCGATGGACCAAG NA/721
FLUAN1–924R CTGGTTGAAAGACACCCAC NA/924
FLUAN1–904R GTCGATTCGAGCCATGCCAG NA/904
MBTuni-12† ACGCGTGATCAGCAAAAGCAGG NA/5′ UTR
MBTuni-13† ACGCGTGATCAGTAGAAACAAGG NA/3′ UTR

*NA, neuraminidase; UTR, untranslated region.
†Primer sets previously published in 2009 (11).

Main Article

References
  1. Garten  RJ, Davis  CT, Russell  CA, Shu  B, Lindstrom  S, Balish  A, Antigenic and genetic characteristics of swine-origin 2009 A(H1N1). Science. 2009;325:197201. Epub 2009 May 22. DOIPubMedGoogle Scholar
  2. Smith  GJ, Vijaykrishna  D, Bahl  J, Lycett  SJ, Worobey  M, Pybus  OG, Origins and evolutionary genomics of the 2009 swine-origin H1N1 influenza A epidemic. Nature. 2009;459:11225. DOIPubMedGoogle Scholar
  3. World Health Organization. Pandemic (H1N1) 2009—update 101. Weekly update [cited 2010 May 21]. http://www.who.int/csr/don/2010_05_21/en/index.html
  4. Secretaría de Salud. Estadísticas de la epidemia. Influenza A (H1N1) [cited 2010 May 17]. http://portal.salud.gob.mx/contenidos/noticias/influenza/estadisticas.html
  5. Deyde  VM, Sheu  TG, Trujillo  AA, Okomo-Adhiambo  M, Garten  R, Klimov  AI, Detection of molecular markers of drug resistance in 2009 pandemic influenza A (H1N1) viruses by pyrosequencing. Antimicrob Agents Chemother. 2010;54:110210. DOIPubMedGoogle Scholar
  6. Chen  H, Cheung  CHL, Tai  H, Zhao  P, Chan  JFW, Cheng  VCC, Oseltamivir-resistant influenza pandemic (H1N1) 2009 virus, Hong Kong, China. Emerg Infect Dis. 2009;15:19702. DOIPubMedGoogle Scholar
  7. World Health Organization. Weekly update on oseltamivir resistance to pandemic influenza A (H1N1) 2009 viruses [cited 2010 Apr 14]. http://www.who.int/csr/disease/swineflu/oseltamivirresistant20100416.pdf
  8. Sheu  TG, Deyde  VM, Okomo-Adhiambo  M, Garten  RJ, Xu  X, Bright  RA, Surveillance for neuraminidase inhibitor resistance among human influenza A and B viruses circulating worldwide from 2004 to 2008. Antimicrob Agents Chemother. 2008;52:328492. DOIPubMedGoogle Scholar
  9. Dharan  NJ, Gubareva  LV, Meyer  JJ, Okomo-Adhiambo  M, McClinton  RC, Marshall  SA, Infections with oseltamivir-resistant influenza A(H1N1) virus in the United States. JAMA. 2009;301:103441. DOIPubMedGoogle Scholar
  10. Hurt  AC, Holien  JK, Parker  M, Kelso  A, Barr  IG. Zanamivir-resistant influenza viruses with a novel neuraminidase mutation. J Virol. 2009;83:1036673. DOIPubMedGoogle Scholar
  11. Zhou  B, Donnelly  ME, Scholes  DT, St George  K, Hatta  M, Kawaoka  Y, Single-reaction genomic amplification accelerates sequencing and vaccine production for classical and swine origin human influenza A viruses. J Virol. 2009;83:1030913. Epub 2009 Jul 15. DOIPubMedGoogle Scholar
  12. Kilander  A, Rykkvin  R, Dudman  SG, Hungnes  O. Observed association between the HA1 mutation D222G in the 2009 pandemic influenza A(H1N1) virus and severe clinical outcome, Norway 2009–2010. Euro Surveill. 2010;15:pii:19498. PMID: 20214869
  13. Gubareva  LV, Kaiser  L, Matrosovich  MN, Soo-Hoo  Y, Hayden  FG. Selection of influenza virus mutants in experimentally infected volunteers treated with oseltamivir. J Infect Dis. 2001;183:52331. DOIPubMedGoogle Scholar
  14. Hauge  SH, Dudman  S, Borgen  K, Lackenby  A, Hungnes  O. Oseltamivir-resistant influenza viruses A (H1N1), Norway, 2007–08. Emerg Infect Dis. 2009;15:15562. DOIPubMedGoogle Scholar
  15. Centers for Disease Control and Prevention. Update: drug susceptibility of swine-origin influenza A (H1N1) viruses, April 2009. MMWR Morb Mortal Wkly Rep. 2009;58:4335.PubMedGoogle Scholar

Main Article

Page created: July 13, 2011
Page updated: July 13, 2011
Page reviewed: July 13, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.
file_external