Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 4—April 2011

Dispatch

Rapid Genotyping of Swine Influenza Viruses

Polly W.Y. Mak, Chloe K.S. Wong, Olive T.W. Li, Kwok Hung Chan, Chung Lam Cheung, Edward S. Ma, Richard J. Webby, Yi Guan, Joseph S. Malik Peiris, and Leo L.M. PoonComments to Author 
Author affiliations: Author affiliations: The University of Hong Kong, Hong Kong Special Administrative Region, People’s Republic of China (P.W.Y. Mak, C.K.S. Wong, O.T.W. Li, K.H. Chan, C.L. Cheung, E.S. Ma, Y. Guan, J.S.M. Peiris, L.L.M. Poon); St. Jude Children’s Research Hospital, Memphis, Tennessee, USA (R.J. Webby); Hong Kong University–Pasteur Research Centre, Hong Kong (J.S.M. Peiris)

Main Article

Table 1

Primer–probe sets selective for pandemic (H1N1) 2009 virus gene segments*

Segment Primer and probe† Sequence, 5′ → 3′‡
PB2 PB2-1877F§ AACTTCTCCCCTTTGCTGCT
PB2-2062R§ GATCTTCAGTCAATGCACCTG

PB2-2028RP
Cy5-AACTGTAAGTCGTTTGGT-BHQ2
PB1 PB1-825F§ ACAGTCTGGGCTCCCAGTA
PB1-1023R GAACCACTCGGGTTGATTTCTG

PB1-863FP
Cy5-CCAAACTGGCAAATG-BHQ2
PA PA-821F§ GCCCCCTCAGATTGCCTG
PA-1239R§ GCTTGCTAGAGATCTGGGC

PA-844FP
Cy5-CCTCTTTGCCATCAGC-BHQ2
HA HA-398F§ GAGCTCAGTGTCATCATTTGAA
HA-570R§ TGCTGAGCTTTGGGTATGAA

HA-470FP
Cy5-CAAAGGTGTAACGGCA-BHQ2
NP NP-593F§ TGAAAGGAGTTGGAACAATAGCAA
NP-942R§ GACCAGTGAGTACCCTTCCC

NP-872RP
Cy5-AGGCAGGATTTATGTG-BHQ2
NA NA-163F§ CATGCAATCAAAGCGTCATT
NA-268R§ ACGGAAACCACTGACTGTCC

NA-248RP
Cy5-AGCAGCAAAGTTGGTG-BHQ2
M M-504F§ GGTCTCACAGACAGATGGCT
M-818R§ GATCCCAATGATATTTGCTGCAATG

M-530FP
Cy5-ACCAATCCACTAATCAGG-BHQ2
NS NS-252F§ ACACTTAGAATGACAATTGCATCTGT
NS-345R GCATGAGCATGAACCAGTCTCG
NS-288FP Cy5-CGCTACCTTTCTGACAT/BHQ2/

*PB, polymerase basic protein; PA, polymerase acidic protein; HA, hemagglutinin; NP, nucleocapsid protein; NA, neuraminidase; M, matrix protein; NS, nonstructural protein; Cy5, cyanine 5; BHQ2, Black Hole Quencher 2.
†Number represents nucleotide position of the first base in the target sequence (cRNA sense).
‡Locked nucleic acid–modified bases are underlined.
§Primers adapted from the assays as previously described (5,6).

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO