Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 6—June 2011


Multidrug-Resistant Acinetobacter baumannii Harboring OXA-24 Carbapenemase, Spain

Joshi Acosta, María Merino, Esther Viedma, Margarita Poza, Francisca Sanz, Joaquín R. Otero, Fernando Chaves, and Germán BouComments to Author 
Author affiliations: Author affiliations: Hospital Universitario 12 de Octubre, Madrid, Spain (J. Acosta, E. Viedma, F. Sanz, J.R. Otero, F. Chaves); Complejo Hospitalario Universitario La Coruña, La Coruña, Spain (M. Merino, M. Poza, G. Bou)

Main Article

Table 2

Oligonucleotides used in real-time reverse transcription PCRs for Acinetobacter baumannii, Spain*

Primer Gene Sequence, 5′ → 3′
TonB-Forw TonB-dependent receptor GGACTGGTGATAAAGCACTAT
TonB-Rev TonB-dependent receptor GCCGCATAGAGTTATCACATC
Septicolysin-Forw Septicolysin CACCATCTTGTACCAATACATTT
Septicolysin-Rev Septicolysin GAAATTAGCAGAAGCTCTCTTAC
rpoB-Forw RNA polymerase subunit B CAGCCGCGAYCAGGTTGACTACA

*Forw, forward; rev, reverse.

Main Article

1These authors contributed equally to this article.

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO