Volume 17, Number 8—August 2011
Dispatch
Aichi Virus Shedding in High Concentrations in Patients with Acute Diarrhea
Table 1
PCR oligonucleotides used for AiV amplification and quantification, Germany, 2004*
| ID no. | Sequence, 5′ → 3′ | Position† | Genome location | Orientation | RT-PCR type | Usage |
|---|---|---|---|---|---|---|
| AiV-F65 | CACCGTTACTCCATTCAGCTTCTTC | 65–89 | 5′ UTR | + | Nested, 1st round‡ | Determination of suitable genomic target region for quantitative real-time RT-PCR |
| AiV-F69 | GTTACTCCATTCAGCTTCTTCGGAAC | 69–94 | 5′ UTR | + | Nested, 2nd round§ | |
| AiV-R1039 | CAGGATTGGACATCAGAATCATAGAG | 1039–1064 | Leader | – | Nested, 2nd round§ | |
| AiV-R1049 |
GGATAGAACCAGGATTGGACATCAG |
1049–1073 |
Leader |
– |
Nested, 1st round‡ |
|
| AiV-F274 | CCAGCCTGACGTATCACAGG | 274–293 | 5′ UTR | + | Real-time¶ | Viral RNA quantification |
| AiV-R313 | AAGCTGCTCACGTGGCAATTGTG | 313–335 | 5′ UTR | – | Real-time¶ | |
| AiV-P294 |
FAM-CTGTGTGAAGYCC-MGBNFQ |
294–306 |
5′ UTR |
+ (probe) |
Real-time¶ |
|
| AiV-F2984 | CAGGCATTCATCTCYGCAGGTGAA | 2984–3007 | VP1 | + | Nested, 1st round‡ | Determination of viral genotype |
| AiV-F2995 | CTCYGCAGGTGAATCCTTCAACGT | 2995–3018 | VP1 | + | Nested, 2nd round§ | |
| AiV-R3881 | GATGGCCCAGTGGACGTAGGT | 3881–3901 | VP1 | – | Nested, 2nd round§ | |
| AiV-R3884 | TTGCGGATGGCCCAGTGGACGTA | 3884–3906 | VP1 | – | Nested, 1st round‡ |
*AiV, Aichi virus; ID, identification; RT-PCR, reverse transcription PCR; UTR, untranslated region.
†Relative to AiV GenBank accession no. AB040749.
‡25-µL QIAGEN OneStep RT-PCR reactions as described by the manufacturer (QIAGEN, Hilden, Germany) used 400 nmol/L each of 1st-round primers, 1 µg bovine serum albumin, and 5 µL RNA extract. Amplification involved 30 min at 50°C; 15 min at 95°C; 10 cycles of 20 s at 94°C, 30 s starting at 60°C with a decrease of 1°C per cycle, and 50 s at 72°C; and 40 cycles of 20 s at 95°C, 30 s at 54°C, and 50 s at 72°C; and a final elongation step of 5 min at 72°C.
§50-µL Platinum Taq reactions as described by the manufacturer (Invitrogen, Karlsruhe, Germany) used 1 µL of 1st-round PCR product, 2.5 mmol/L MgCl2, and 400 nmol/L each of 2nd-round primers. Amplification involved 3 min at 94°C and 45 cycles of 20 s at 94°C, 30 s at 60°C, and 40 s at 72°C.
¶25-µL QIAGEN OneStep RT-PCR reactions used 3 µL of RNA extract, 600 nmol/L of each primer, and 320 nmol/L of the probe. Cycling in an Applied Biosystems (Darmstadt, German) 7700 SDS instrument involved the following steps: 55°C for 15 min, 95°C for 15 min, and 45 cycles of 95°C for 15 s and 58°C for 30 s (fluorescence measured).


