Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 8—August 2011


Aichi Virus Shedding in High Concentrations in Patients with Acute Diarrhea

Jan Felix Drexler, Sigrid Baumgarte, Luciano Kleber de Souza Luna, Monika Eschbach-Bludau, Alexander N. Lukashev, and Christian DrostenComments to Author 
Author affiliations: Author affiliations: University of Bonn Medical Centre, Bonn, Germany (J.F. Drexler, M. Eschbach-Bludau, C. Drosten); Institute of Hygiene and the Environment, Hamburg, Germany (S. Baumgarte); Bernhard Nocht Institute for Tropical Medicine, Hamburg (L.K. de Souza Luna); Chumakov Institute of Poliomyelitis and Viral Encephalitides, Moscow, Russia (A.N. Lukashev)

Main Article

Table 1

PCR oligonucleotides used for AiV amplification and quantification, Germany, 2004*

ID no. Sequence, 5′ → 3′ Position† Genome location Orientation RT-PCR type Usage
AiV-F65 CACCGTTACTCCATTCAGCTTCTTC 65–89 5′ UTR + Nested, 1st round‡ Determination of suitable genomic target region for quantitative real-time RT-PCR
AiV-F69 GTTACTCCATTCAGCTTCTTCGGAAC 69–94 5′ UTR + Nested, 2nd round§
AiV-R1039 CAGGATTGGACATCAGAATCATAGAG 1039–1064 Leader Nested, 2nd round§

Nested, 1st round‡
AiV-F274 CCAGCCTGACGTATCACAGG 274–293 5′ UTR + Real-time¶ Viral RNA quantification
5′ UTR
+ (probe)
AiV-F2984 CAGGCATTCATCTCYGCAGGTGAA 2984–3007 VP1 + Nested, 1st round‡ Determination of viral genotype
AiV-F2995 CTCYGCAGGTGAATCCTTCAACGT 2995–3018 VP1 + Nested, 2nd round§
AiV-R3881 GATGGCCCAGTGGACGTAGGT 3881–3901 VP1 Nested, 2nd round§
AiV-R3884 TTGCGGATGGCCCAGTGGACGTA 3884–3906 VP1 Nested, 1st round‡

*AiV, Aichi virus; ID, identification; RT-PCR, reverse transcription PCR; UTR, untranslated region.
†Relative to AiV GenBank accession no. AB040749.
‡25-µL QIAGEN OneStep RT-PCR reactions as described by the manufacturer (QIAGEN, Hilden, Germany) used 400 nmol/L each of 1st-round primers, 1 µg bovine serum albumin, and 5 µL RNA extract. Amplification involved 30 min at 50°C; 15 min at 95°C; 10 cycles of 20 s at 94°C, 30 s starting at 60°C with a decrease of 1°C per cycle, and 50 s at 72°C; and 40 cycles of 20 s at 95°C, 30 s at 54°C, and 50 s at 72°C; and a final elongation step of 5 min at 72°C.
§50-µL Platinum Taq reactions as described by the manufacturer (Invitrogen, Karlsruhe, Germany) used 1 µL of 1st-round PCR product, 2.5 mmol/L MgCl2, and 400 nmol/L each of 2nd-round primers. Amplification involved 3 min at 94°C and 45 cycles of 20 s at 94°C, 30 s at 60°C, and 40 s at 72°C.
¶25-µL QIAGEN OneStep RT-PCR reactions used 3 µL of RNA extract, 600 nmol/L of each primer, and 320 nmol/L of the probe. Cycling in an Applied Biosystems (Darmstadt, German) 7700 SDS instrument involved the following steps: 55°C for 15 min, 95°C for 15 min, and 45 cycles of 95°C for 15 s and 58°C for 30 s (fluorescence measured).

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO