Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 18, Number 10—October 2012

Dispatch

Human Polyomaviruses in Children Undergoing Transplantation, United States, 2008–2010

Erica A. Siebrasse, Irma Bauer, Lori R. Holtz, Binh-minh Le, Sherry Lassa-Claxton, Charles Canter, Paul Hmiel, Shalini Shenoy, Stuart Sweet, Yumirle Turmelle, Ross Shepherd, and David WangComments to Author 
Author affiliations: Washington University School of Medicine, St. Louis, Missouri, USA

Main Article

Table 1

Real-time PCR assays to detect human polyomaviruses in children undergoing transplants, United States, 2008–2010*

Virus Target Primers, 5′ → 3′ Probe, 5′ → 3′
WUPyV NCCR WU-C-4824-F: GGCACGGCGCCAACT WU-C-4861-TM: FAM-TGCCATACCAACACAGCTGCTGAGC-TAMRA-3′
WU-C-4898-R: CCTGTTGTAGGCCTTACTTACCTGTA
KIPyV LTAg KI-B-4603-F: GAATGCATTGGCATTCGTGA KI-B-4632-TM: FAM-TGTAGCCATGAATGCATACATCCCACTGC-TAMRA
KI-B-4668-R: GCTGCAATAAGTTTAGATTAGTTGGTGC
TSPyV LTAg LTF: TGTGTTTGGAAACCAGAATCATTTG LTP: FAM-TTCTTCTTCCTCCTCATCCTCCACCTCAAT-TAMRA
LTR: TGCTACCTTGCTATTAAATGTGGAG
MCPyV LTAg LT.1F: CCACAGCCAGAGCTCTTCCT LT probe: FAM-TCCTTCTCAGCGTCCCAGGCTTCA-TAMRA
LT.1R: TGGTGGTCTCCTCTCTGCTACTG
HPyV6 VP1 ES011F: GCCTGGAAGGGCCTAGTAAAG ES024: FAM-ACCAACCATCTGTTGCAGGCATTAAAGCTA-TAMRA
ES012R: ATTGGCAGCTGTAACTTGTTTTCTG
HPyV7 VP1 ES017F: GGTCCAGGCAATACTGATGTAGCTA ES025: FAM-CCTGCAAGCCCTCAGAAAGCAAGTAAATG-TAMRA
ES018R: TCTGCAACCCAGAGCTCTACTG
HPyV9 LTAg ES026F: GAAGACCCTGATCCTGAGGAAGA ES031: FAM-TGGATCATCCCAGAGTTCATTTACCTGCA-TAMRA
ES027R: CTCTGGAGTATTAGGTTCAGGCTTCT
BKPyV LTAg BK-Deg-F: AGCAGGCAAGRGTTCTATTACTAAAT Bk-Deg-P: FAM-AAGACCCTAAAGACTTTCCYTCTGATCTACACCAGTTT-TAMRA
BK-Deg-R: GARGCAACAGCAGATTCYCAACA
JCPyV VP2/3 JL1 (F): AAGGGAGGGAACCTATATTTCTTTTG JL1 (P): FAM-CTCATACACCCAAAGTATAGATGATGCAGACAGCA-TAMRA
JL1 (R): TCTAGCCTTTGGGTAACTTCTTGAA

*WUPyV, WU polyomavirus; NCCR, non-coding control region; KIPyV, KI polyomavirus; LTAg, large T antigen; TSPyV, trichodysplasia spinulosa polyomavirus; MCPyV, Merkel cell polyomavirus; HPyV, human polyomavirus; VP, virion protein; BKPyV, BK polyomavirus; JCPyV, JC polyomavirus.

Main Article

TOP