Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 12—December 2012

Research

Reservoir Competence of Wildlife Host Species for Babesia microti

Michelle H. HershComments to Author , Michael Tibbetts, Mia Strauss, Richard S. Ostfeld, and Felicia Keesing
Author affiliations: Bard College, Annandale-on-Hudson, New York, USA (M.H. Hersh, M. Tibbetts, M. Strauss, F. Keesing); and Cary Institute of Ecosystem Studies, Millbrook, New York, USA (M.H. Hersh, R.S. Ostfeld)

Main Article

Table 3

Sequences of Babesia microti 18S rDNA from newly molted nymphal Ixodes scapularis ticks fed on vertebrate hosts aligned with sequences from known zoonotic isolates and raccoon isolates from GenBank, southeastern New York, USA, 2008–2010*

Species Sequence, 5′ → 3′
Didelphis virginiana A20030_21 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGTATTCAACGAGTTTTTTCCTTGGC
Procyon lotor 506_10 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGTATTCAACGAGTTTTTTCCTTGGC
Babesia microti raccoon isolate, USA (AY144701) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGTATTCAACGAGTTTTTTCCTTGGC
B. microti raccoon isolate, Japan (AB197940) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGTATTCAACGAGTTTTTTCCTTGGC
Blarina brevicauda BB3_10 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Catharus fuscescens, 2341–01870_17 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Hylocichla mustelina 1951–10576_14 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Peromyscus leucopus A20003_10 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Sciurus carolinensis E412_14 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
Tamias striatus H1037_11 AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
B. microti GI strain (AF231348) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
B. microti Jena/Germany isolate (EF413181) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG-TTTTTCCTTGGC
B. microti Kobe isolate (AB032434) AAGGCAATAACAGGTCTGTGATGCCCTTAGATGTCCTGGGCTGCACGCGCGCTACACTGATGCATTCAACGAG--TTTTCCTTGGC

*Sequences for zoonotic isolates were obtained from Gray et al. (4). The 85–86-bp sequence is the region of 18S rDNA between primers smbaJF and smbaKR. Consistent 2-bp differences between ticks collected from different host species are indicated in boldface. The empty row separates sequences with basepair differences. Accessions nos. for GenBank sequences are indicated in parentheses after isolate names. GI, American isolate.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO