Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 4—April 2012

Letter

Rickettsia monacensis as Cause of Mediterranean Spotted Fever–like Illness, Italy

Giordano MadedduComments to Author , Fabiola Mancini, Antonello Caddeo, Alessandra Ciervo, Sergio Babudieri, Ivana Maida, Maria Laura Fiori, Giovanni Rezza, and Maria Stella Mura
Author affiliations: University of Sassari, Sassari, Italy (G. Madeddu, A. Caddeo, S. Babudieri, I. Maida, M.L. Fiori, M.S. Mura); Istituto Superiore di Sanità, Rome, Italy (F. Mancini, A. Ciervo, G. Rezza)

Main Article

Table

Selected inner primers used to amplify rickettsial gltA and ompA genes*

Rickettsial groups Gene Primer Nucleotide sequence, 5′ → 3′ Product size, bp Reference
Rickettsiae spotted fever group plus typhus group gtlA gltA–F TCGCAAATGTTCACGGTACTTT 74 (8)
gltA–R TCGTGCATTTCTTTCCATTGTG
Rickettsiae ompA ompA ompA–F ATGGCGAATATTTCTCCAAAA 632 (9)
ompA–R GTTCCGTTAATGGCAGCATCT

*gltA, citrate synthase; ompA, outer membrane protein A.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO