Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 8—August 2012

Dispatch

New Variants of Porcine Epidemic Diarrhea Virus, China, 2011

Wentao Li, Heng Li, Yunbo Liu, Yongfei Pan, Feng Deng, Yanhua Song, Xibiao Tang, and Qigai HeComments to Author 
Author affiliations: Huazhong Agricultural University, Wuhan, People’s Republic of China (W. Li, H. Li; F. Deng, X. Tang, Q. He); and Guangdong Wen’s Foodstuffs Group Company, Ltd., Xinxing, People’s Republic of China (Y. Pan, Y. Song)

Main Article

Table 1

Primers used in study of PEDV, China, 2011*

Primer name Nucleotide sequence, 5′ → 3′ Primer location†
PEDVS1F GGTAAGTTGCTAGTGCGTAA 20,570–20,589
PEDVS1R CAGGGTCATCACAATAAAGAA 22,010–22,030
PEDVS2F TTTCTGGACCGTAGCATC 21,939–21,956
PEDVS2R TCCTGAAGTGGGACATAG 22,917–22,935
PEDVS3F GAGTTGCCTGGTTTCTTC 22,816–22,833
PEDVS3R TATAATTGCGCCTCAAAG 24,979–24,996

*PEDV, porcine epidemic diarrhea virus; F, forward; R, reverse.
†Numbers correspond to the nucleotide positions within the CV777 genome.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO