Emerging Infectious Disease ISSN: 1080-6059

HIV-1 Group O Virus Identified for the First Time in the United States

M. A. Rayfield*, P. Sullivan†, C. I. Bandea*, L. Britvan‡, R. A. Otten*, C. P. Pau*, D. Pieniazek*, S. Subbarao*, P. Simon†, C. A. Schable*, A. C. Wright*, J. Ward†, and G. Schochetman*

Author affiliations: Author Affiliations: ; *National Center for Infectious Diseases; †National Center for HIV, STD and TB Prevention, Centers for Disease Control and Prevention, Atlanta, Georgia, USA; ‡Kaiser Permanente Medical Group, Los Angeles, California, USA

Main Article

Figure 1

Phylogenetic analysis of the prt and env gene sequences. The patient's isolate is indicated by the arrow. The trees were constructed on the basis of the proviral DNA sequences for the protease gene (A) by the neighbor-joining method in the Phylip 3.5c package (2) and 230 aligned nucleotides from the C2V3 region of the env gene of Group O isolates (B) by using the maximum likelihood method with the fast DNAml program (1). Numbers at the branch nodes within the protease tree indicate bootstrap val

Figure 1. Phylogenetic analysis of the prt and env gene sequences. The patient's isolate is indicated by the arrow. The trees were constructed on the basis of the proviral DNA sequences for the protease gene (A) by the neighbor-joining method in the Phylip 3.5c package (2) and 230 aligned nucleotides from the C2V3 region of the env gene of Group O isolates (B) by using the maximum likelihood method with the fast DNAml program (1). Numbers at the branch nodes within the protease tree indicate bootstrap values. The SIV-MM251 protease gene sequence and the SIV-CPZ env sequence were used as outgroups in trees A and B, respectively. The nucleotide sequence distance among strains can be deduced from the horizontal branch lengths by using the included bar scale. Vertical distances are for clarity only.

Main Article

¹Primers: gag/outer/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/outer/ reversed - CCTACTCCCTGACAGGCCGT CAGCATTTCTTC; gag/inner/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/inner/reverse - CCTTAAGCTTTTGT AGAATCTATCTACATA; protease/outer/forward - TTTGCCTCCCTCAAATC; protease/outer/reverse - TTACTGGCACTG GGGCTATGG; protease/inner/ forward - CCTCAAATCCCTCTTTG; protease/inner/reverse - TATAGGGAAGTTTAGTGTACA; env/outer/forward - CACAGAATTTAATGGAACAGGC; env/outer/reverse - TGTGTT ACAATAAAAGAATTCTCC; env/inner/forward - GTTACTTGTACACATGGCAT; and env/inner/reverse - AGAATTCTCCATGACAGTTAAA.

Top of Page

The opinions expressed by authors contributing to this journal do not necessarily reflect the opinions of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.