Skip directly to local search Skip directly to A to Z list Skip directly to navigation Skip directly to site content Skip directly to page options
CDC Home

Volume 2, Number 3—July 1996

Dispatch

HIV-1 Group O Virus Identified for the First Time in the United States

M. A. Rayfield*, P. Sullivan†, C. I. Bandea*, L. Britvan‡, R. A. Otten*, C. P. Pau*, D. Pieniazek*, S. Subbarao*, P. Simon†, C. A. Schable*, A. C. Wright*, J. Ward†, and G. Schochetman*
Author affiliations: Author Affiliations: ; *National Center for Infectious Diseases; †National Center for HIV, STD and TB Prevention, Centers for Disease Control and Prevention, Atlanta, Georgia, USA; ‡Kaiser Permanente Medical Group, Los Angeles, California, USA

Main Article

Figure 1

Phylogenetic analysis of the prt and env gene sequences. The patient's isolate is indicated by the arrow. The trees were constructed on the basis of the proviral DNA sequences for the protease gene (A) by the neighbor-joining method in the Phylip 3.5c package (2) and 230 aligned nucleotides from the C2V3 region of the env gene of Group O isolates (B) by using the maximum likelihood method with the fast DNAml program (1). Numbers at the branch nodes within the protease tree indicate bootstrap val

Figure 1. Phylogenetic analysis of the prt and env gene sequences. The patient's isolate is indicated by the arrow. The trees were constructed on the basis of the proviral DNA sequences for the protease gene (A) by the neighbor-joining method in the Phylip 3.5c package (2) and 230 aligned nucleotides from the C2V3 region of the env gene of Group O isolates (B) by using the maximum likelihood method with the fast DNAml program (1). Numbers at the branch nodes within the protease tree indicate bootstrap values. The SIV-MM251 protease gene sequence and the SIV-CPZ env sequence were used as outgroups in trees A and B, respectively. The nucleotide sequence distance among strains can be deduced from the horizontal branch lengths by using the included bar scale. Vertical distances are for clarity only.

Main Article

1Primers: gag/outer/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/outer/ reversed - CCTACTCCCTGACAGGCCGT CAGCATTTCTTC; gag/inner/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/inner/reverse - CCTTAAGCTTTTGT AGAATCTATCTACATA; protease/outer/forward - TTTGCCTCCCTCAAATC; protease/outer/reverse - TTACTGGCACTG GGGCTATGG; protease/inner/ forward - CCTCAAATCCCTCTTTG; protease/inner/reverse - TATAGGGAAGTTTAGTGTACA; env/outer/forward - CACAGAATTTAATGGAACAGGC; env/outer/reverse - TGTGTT ACAATAAAAGAATTCTCC; env/inner/forward - GTTACTTGTACACATGGCAT; and env/inner/reverse - AGAATTCTCCATGACAGTTAAA.

Top of Page

 

Past Issues

Select a Past Issue:

SARS 10th Anniversary logo

podcast icon


Lessons from the History of Quarantine, from Plague to Influenza A

Listen now or download MP3

Length: 23:11



CDC 24/7 – Saving Lives, Protecting People, Saving Money. Learn More About How CDC Works For You…

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO