Skip directly to local search Skip directly to A to Z list Skip directly to navigation Skip directly to site content Skip directly to page options
CDC Home

Volume 2, Number 3—July 1996

Dispatch

HIV-1 Group O Virus Identified for the First Time in the United States

M. A. Rayfield*, P. Sullivan†, C. I. Bandea*, L. Britvan‡, R. A. Otten*, C. P. Pau*, D. Pieniazek*, S. Subbarao*, P. Simon†, C. A. Schable*, A. C. Wright*, J. Ward†, and G. Schochetman*
Author affiliations: Author Affiliations: ; *National Center for Infectious Diseases; †National Center for HIV, STD and TB Prevention, Centers for Disease Control and Prevention, Atlanta, Georgia, USA; ‡Kaiser Permanente Medical Group, Los Angeles, California, USA

Main Article

Figure 2

Alignment of deduced amino acid sequences of the env C2V3 region of the CDC7755 strain with those of three representative Group O Cameroonian strains (ANT70C, MVP5180 and FR.VAU). The CONS-O represents the consensus amino acid sequence derived from the four strains presented in this alignment. (?) represents positions where a consensus could not be derived. (-) indicates identical amino acids with the CONS-O and (*) indicates gaps (insertion\deletions) that were introduced to align the sequences

Figure 2. Alignment of deduced amino acid sequences of the env C2V3 region of the CDC7755 strain with those of three representative Group O Cameroonian strains (ANT70C, MVP5180 and FR.VAU). The CONS-O represents the consensus amino acid sequence derived from the four strains presented in this alignment. (?) represents positions where a consensus could not be derived. (-) indicates identical amino acids with the CONS-O and (*) indicates gaps (insertion\deletions) that were introduced to align the sequences. 
NOTE: This table may not fit on page unless printed in landscape mode.

Main Article

1Primers: gag/outer/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/outer/ reversed - CCTACTCCCTGACAGGCCGT CAGCATTTCTTC; gag/inner/forward - AGTACATGTTAAAACATGTAGTATGGGC; gag/inner/reverse - CCTTAAGCTTTTGT AGAATCTATCTACATA; protease/outer/forward - TTTGCCTCCCTCAAATC; protease/outer/reverse - TTACTGGCACTG GGGCTATGG; protease/inner/ forward - CCTCAAATCCCTCTTTG; protease/inner/reverse - TATAGGGAAGTTTAGTGTACA; env/outer/forward - CACAGAATTTAATGGAACAGGC; env/outer/reverse - TGTGTT ACAATAAAAGAATTCTCC; env/inner/forward - GTTACTTGTACACATGGCAT; and env/inner/reverse - AGAATTCTCCATGACAGTTAAA.

Top of Page

 

Past Issues

Select a Past Issue:

Art in Science - Selections from Emerging Infectious Diseases
Now available for order



CDC 24/7 – Saving Lives, Protecting People, Saving Money. Learn More About How CDC Works For You…

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO