Volume 21, Number 10—October 2015
Letter
Human Infections with Pseudoterranova cattani Nematodes, Chile
Table
Isolate | ITS1 sequence at 240–270 nt | GenBank accession no. |
---|---|---|
Pc1 | CTCTGTT--------------AACGCAGAGT | AJ413981 |
CL#3 | CTCTGTT--------------AACGCAGAGT | KF781284 |
PdCa1 | CTCTGTTTTGGTTTCAACGCTAACGCAGAGT | AJ413979 |
*CL#3, specimen from Chile; Pc1; ITS, internal transcribed spacer. Pc1, P. cattani; PdCa1, P. decipiens.
1These authors contributed equally to this article.
Page created: January 19, 2016
Page updated: January 19, 2016
Page reviewed: January 19, 2016
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.