Skip directly to local search Skip directly to A to Z list Skip directly to navigation Skip directly to site content Skip directly to page options
CDC Home

Volume 3, Number 2—June 1997

Dispatch

A New Tick-borne Encephalitis-like Virus Infecting New England Deer Ticks, Ixodes dammini1

Sam R. Telford*, Philip M. Armstrong*, Paula Katavolos*, Ivo Foppa*, A. Sonia Olmeda Garcia*†, Mark L. Wilson‡, and Andrew Spielman*
Author affiliations: *Harvard School of Public Health, Boston, Massachusetts, USA; †Universidad Complutense de Madrid, Spain; and ‡Yale University School of Medicine, New Haven, Connecticut, USA

Main Article

Figure 2

Maximum parsimony phylogram indicating the relationship of deer tick virus (DTV) to other tick-borne encephalitis group viruses. Sequences in GenBank for representative tick-borne flavivirus envelope genes were aligned and compared by using yellow fever virus as the outgroup. Values above branches indicate bootstrapped confidence values. Branch lengths are proportional to percent similarity in sequence. IPS 001, mouse brain derived DTV (Massachusetts isolate); CT390, mouse brain derived DTV (Con

Figure 2. Maximum parsimony phylogram indicating the relationship of deer tick virus (DTV) to other tick-borne encephalitis group viruses. Sequences in GenBank for representative tick-borne flavivirus envelope genes were aligned and compared by using yellow fever virus as the outgroup. Values above branches indicate bootstrapped confidence values. Branch lengths are proportional to percent similarity in sequence. IPS 001, mouse brain derived DTV (Massachusetts isolate); CT390, mouse brain derived DTV (Connecticut isolate). POW, Powassan virus; TBE, tick borne encephalitis; TSE, Turkish sheep encephalitis; GGE, Greek goat encephalitis; LI, louping ill virus; SSE, Spanish sheep encephalitis; KFD, Kyasanur Forest disease virus; TYU, Tyuleniy virus; SRE, Saumarez Reef virus. The topology of the phylogram that was independently derived from NS-5 does not differ from that of env and is not presented. Approximately 100 ng of extracted RNA was added to a 20 mL reverse transcriptase (RT) reaction containing 5mM MgCl2, 50mM KCl, 100mM tris-HCl (pH 8.3), 5mM each of the four deoxynucleotides, 20U RNase Inhibitor, 50U RT, and 25 pmols of the appropriate downstream primer (POW-2 [5' GCTCTCTAGCTTGAGCTCCCA 3'] or POW-6 [5'TTGTGTTTCCAGGGCAGCGCCA 3']). To a 50 µL PCR reaction using the Elongase system (BRL Life Technologies) and a final Mg++ concentration of 1.5mM was added 1/20th of the RT reaction and 25pmol of primers POW-1 [5'TGGATGACAACAGAAGACATGC 3'] and POW-2, which amplify a 291 bp region of the TBE virus complex nonstructural protein gene (NS-5). Alternatively, primers POW-6 and ENV-A [5'GTCGACGACGAGGTGCACGCATCTTGA 3'] were added to amplify a 689 bp region of the TBE virus envelope gene (env). Sequences derived from RT-PCR were compared with those accessioned in GenBank. Sequence alignments were generated with the PILEUP program of the Wisconsin Genetics Computer Group, and these prealigned sequences were analyzed by parsimony using PAUP 3.1 (D. Swofford, Illinois Natural History Survey, Champaign, IL) with yellow fever virus as the outgroup. Characters were equally weighted and treated as unordered. Phylogenies were constructed by using the heuristic search option with the tree bisection reconnection branch swapping method. The robustness of the maximum parsimony tree was estimated by performing 1,000 bootstrapped replicates. Separate comparisons were done for env and NS-5 because fewer NS-5 sequences were available for many of the viruses for which there were env sequences.

Main Article

1The taxonomy continues to be controversial (5).

Top of Page

 

Past Issues

Select a Past Issue:

SARS 10th Anniversary logo

podcast icon


New Flu Virus in Pigs Exhibited at Fairs in Ohio

Listen now or download MP3

Length: 11:58



CDC 24/7 – Saving Lives, Protecting People, Saving Money. Learn More About How CDC Works For You…

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO