Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 4, Number 2—June 1998


Dual Infection with Ehrlichia chaffeensis and a Spotted Fever Group Rickettsia: A Case Report

Daniel J. Sexton*Comments to Author , G. Ralph Corey*, Christopher Carpenter*, Li Quo Kong*, Tejel Gandhi*, Edward Breitschwerdt†, Barbara Hegarty†, Sheng-Ming Chen‡, Hui-Min Feng‡, Xue-jie Yu‡, Juan Olano‡, David H. Walker‡, and Stephen J. Dumler§
Author affiliations: *Duke University Medical Center, Durham, North Carolina, USA; †North Carolina State University, Raleigh, North Carolina, USA; ‡University of Texas Medical Branch at Galveston, Galveston, Texas, USA; §Johns Hopkins Medical Center, Baltimore, Maryland, USA

Main Article

Table 2

Sequences of primers used in amplification of the NadA gene and the 120 kDa protein gene of Ehrlichia chaffeensis

Gene Primers Sequence
120 kDa protein gene pXCF3 5' CAGAATTGATTGTGGAGTTGG 3'
120 kDa protein gene nested pXCF3b 5' CAGCAACAGCAAGAAGATGAC 3'

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO