Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 7, Number 3—June 2001

Correction

Correction: Vol. 6, No. 5

Suggested citation for this article

In the article, “Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska,” by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene.

The first complete sentence at the top of column 1, page 531, should read, “The following set of primers, which detects both stx1 and stx2, was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'.” We regret any confusion this error may have caused.

Suggested Citation for this article: Correction: Vol. 6, No. 5. Emerg Infect Dis [serial on the Internet]. 2001, May [date cited]. http://dx.doi.org/10.3201/eid0703.C10703

DOI: 10.3201/eid0703.C10703

Table of Contents – Volume 7, Number 3—June 2001

Comments to the EID Editors

Please contact the EID Editors via our Contact Form.

TOP