Emerging Infectious Disease ISSN: 1080-6059
Volume 7, Number 3—June 2001
Correction
Correction: Vol. 6, No. 5
Article Contents
Suggested citation for this article
In the article, “Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska,” by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene.
The first complete sentence at the top of column 1, page 531, should read, “The following set of primers, which detects both stx1 and stx2, was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'.” We regret any confusion this error may have caused.
Suggested Citation for this article: Correction: Vol. 6, No. 5. Emerg Infect Dis [serial on the Internet]. 2001, May [date cited]. http://dx.doi.org/10.3201/eid0703.C10703
Comments to the EID Editors
Please contact the EID Editors via our Contact Form.
New Flu Virus in Pigs Exhibited at Fairs in Ohio
Length: 11:58





