Emerging Infectious Disease ISSN: 1080-6059

Correction: Vol. 6, No. 5

Correction
Suggested Citation

In the article, “Prevalence of Non-O157:H7 Shiga Toxin-Producing Escherichia coli in Diarrheal Stool Samples from Nebraska,” by Paul D. Fey et al., an error occurred in reporting a primer used for amplifying the shiga-toxin gene.

The first complete sentence at the top of column 1, page 531, should read, “The following set of primers, which detects both stx1 and stx2, was used: 5' TTTACGATAGACTTCTCGAC 3' and 5' CACATATAAATTATTTCGCTC 3'.” We regret any confusion this error may have caused.

Suggested Citation for this article: Correction: Vol. 6, No. 5. Emerg Infect Dis [serial on the Internet]. 2001, May [date cited]. http://dx.doi.org/10.3201/eid0703.C10703

DOI: 10.3201/eid0703.C10703

Top of Page

Table of Contents – Volume 7, Number 3—June 2001

Comments to the EID Editors

Please contact the EID Editors via our Contact Form.

The opinions expressed by authors contributing to this journal do not necessarily reflect the opinions of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.