Volume 8, Number 12—December 2002
Research
First Isolation of West Nile virus from a Patient with Encephalitis in the United States
Cinnia Huang*
, Brett Slater*, Robert Rudd*, Nandakishore Parchuri†, Rene Hull*, Michelle Dupuis*, and Alexander Hindenburg†
, Brett Slater*, Robert Rudd*, Nandakishore Parchuri†, Rene Hull*, Michelle Dupuis*, and Alexander Hindenburg†Table 1
Oligonucleotide primers and probe used in the standard RT-PCR and TaqMan assaysa
| Primer | Genome target | Genome positionb | Sequence (5′–3′) | RT-PCR product size (bp) |
|---|---|---|---|---|
| CU9093 | NS5 | 9097–9120 | AGYMGRGCHATHTGGTWYATGTGG | 206 |
| CL9279 | NS5 | 9302–9283 | TTCCAVCCDGCKGTRTCATC | |
| D87F | NS5 | 10034–10051 | GCTCCGCTGTCCCTGTGA | 70 |
| D156R | NS5 | 10103–10083 | CACTCTCCTCCTGCATGGATG | |
| Forwardddd | ENV | 1160–1180 | TCAGCGATCTCTCCACCAAAG | 70 |
| Reverse | ENV | 1229–1209 | GGGTCAGCACGTTTGTCATTG | |
| Probe | ENV | 1186–1207 | TGCCCGACCATGGGAGAAGCTC |
aRT-PCR, reverse transcription–polymerase chain reaction.
bGenome position according to GenBank accession no. AF196835.
