Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 8, Number 4—April 2002

Research

Introduction of West Nile Virus in the Middle East by Migrating White Storks

Mertyn Malkinson*Comments to Author , Caroline Banet*, Yoram Weisman*, Shimon Pokamunski†, Roni King‡, Vincent Deubel§, and Marie-Thrse Drouet
Author affiliations: *Kimron Veterinary Institute, Beit Dagan, Israel; †Veterinary Services and Animal Health, Beit Dagan, Israel; ‡Nature and Parks Authority, Jerusalem, Israel; §Pasteur Institute, Lyon, France;

Main Article

Table 2

Oligonucleotide primers used for framing the entire West Nile virus (WNV)a genome and the envelope (E) gene, Israel 98—ST1

Localization in the WNV genome N° nucleotide at the 5′ end Sequence
5′ -end 1 AGTAGTTCGCCTGTGTGAGCTGACAAAC
3′ -end 10,934 (c) AGATCCTGTGTTCTCGCACCACCAGCCAC
M-gene 889 GGATGGATGCTWGGKAGCAAC
NS1-gene 2,557 (c) CCATCCAAGCCTCCACATC

(c)=complementary sequence; W=(A+T); K=(G+T).

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO