Volume 9, Number 7—July 2003
Research
Antimicrobial Resistance Markers of Class 1 and Class 2 Integron-bearing Escherichia coli from Irrigation Water and Sediments
Matthew T. Roe*, Everardo Vega*, and Suresh D. Pillai*
Table
Oligonucleotide primer sequences used for amplification of class 1 and class 2 integrase and variable regions
| Primer | Primer sequence | Target | Reference |
|---|---|---|---|
| integ-1 | 5'-GGCATCCAAGCAAG-3' | 5'-Class 1 integron variable region | Levesque et al. 1995 (13) |
| integ-2 | 5'-AAGCAGACTTGACCTGA-3' | 3'-Class 1 integron variable region | Levesque et al. 1995 (13) |
| hep51 | 5'-GATGCCATCGCAAGTACGAG-3' | 5'-Class 2 integron variable region | White et al. 2001 (14) |
| hep74 | 5'-CGG GATCCCGGACGGCATGCACGATTT GTA-3' | 3'-Class 2 integron variable region | White et al. 2001 (14) |
| intI1.F | 5'-GGGTCAAGGATCTGGATTTCG-3' | 5'-intI1 gene | Mazel et al. 2000 (15) |
| intI1.R | 5'-ACATGGGTGTAAATCATCGTC-3' | 3'-intI1 gene | Mazel et.al. 2000 (15) |
| intI2.F | 5'-CACGGATATGCGACAAAAAGGT-3' | 5'-intI2 gene | Mazel et al. 2000 (15) |
| intI2.R | 5'-GTAGCAAACGAGTGACGAAATG-3' | 5'-intI2 gene | Mazel et al. 2000 (15) |
