Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 1—January 2005

Dispatch

G, N, and P Gene-based Analysis of Chandipura Viruses, India

Vidya A. Arankalle*Comments to Author , Shrotri Sandhya Prabhakar*, Walimbe Atul Madhukar*, Pawar Shailesh Dattatraya*, Mishra Akhilesh Chandra*, and Hanumaih
Author affiliations: *National Institute of Virology, Pune, Maharashtra, India

Main Article

Table 2

Primers used for amplification and sequencing

Gene Primers
G gene
CHAND-G-F1 27-5′ ATGACTTCTTCAGTGACAATTAGT 3′-50
CHAND-G-F2 425-5′ GTCTTGTGGTTATGCTTCTGT 3′-445
CHAND-G-F3 853-5′ TGTGTCCGACCGGGATCAGAGGT 3′-875
CHAND-G-F4 1278-5′ GACAATGAACTACACGAGCT 3′-1297
CHAND-G-R1 1741-5′ TCATCCACCGGGTTGAGATCCAT 3′-1708
CHAND-G-R2 1342-5′ TGAGCATGAGGTAGCTGTGGAT 3′-1321
CHAND-G-R3 30-5′ TCCTCTGAATCTCTGAGGTC 3′-911
CHAND-G-R4 471-5′ TGATTACCAAGAACTCAGAGT 3′-451
N / P gene
CHAND-N-F1 31-5′ TATAGTAGTACACGAACACT 3′-50
CHAND-N-F2 481-5′ TCTTTGGTCTTTATCGTG TGT 3′-501
CHAND-N F3 871-5′ TTGACCAAGCTGATTCCTACAT 3′-892
CHAND-N-F4 1279-5′ TAGGAGATATTCGAGTGAACT 3′-1299
CHAND-N-F5 1742-5′ TGAGTGCTCTCCAACTTCTGCAGT 3′-1765
CHAND-N-F6 2281-5′ CAGATTCTCTGTTGCTTACCACT 3′-2306
CHAND-N-R1 531-5′ TCTTCTTGTACTCGACCTGT 3′-512
CHAND-N-R2 942-5′ TTGAAGAGTAAGGAGACTTCGT 3′-921
CHAND-N-R3 1320-5′ TCCTGGCGTACTCTGCAACT 3′-1301
CHAND-N-R4 1830-5′ TGTGCTGATCTGCAACAGCCT 3′-1810
CHAND-N-R5 2331-5′ TTCTTCAGAGCTTGCATCTTGAT 3′-2309
CHAND-3′-F 11-5′ TATGTCTTATAAGAATGCTATT 3′-32

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO