Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 11—November 2005

Dispatch

Vibrio cholerae Pathogenic Clones

Anna Salim*, Ruiting Lan†, and Peter R. Reeves*Comments to Author 
Author affiliations: *University of Sydney, Sydney, New South Wales, Australia; †University of New South Wales, Sydney, New South Wales, Australia

Main Article

Table A1

Chromosomal location of 26 genes of Vibrio cholerae and primers used*

Gene Chromosomal location† (kb) Forward primer Sequence (5´→3´) Position‡ Reverse primer Sequence (5´→3´) Position§ Amplicon size, bp
gyrB 11 4876 TGGTTTTTGAGGTGGTGGAT 116 4877 CGCTTGATTCTTACGGTTAC 1330 1,214
udhA 141 4968 GAAAAAGAGAGCAGTGTAGG 106 4969 CGTCCCACTTCATAAGGCAC 1131 1,025
purH 280 4970 TCAGCGTATCAGATAAAACC 35 4971 CTTGCCATTCACCACACTCC 1118 1,083
gppA 314 4972 GCCGTTTCTTCACCCTTGTA 10 4973 GGATTTTTTGCCAGCCATTC 1416 1,406
lytB 732 4974 ATGAGCAAACCAATGAAAAT 1 4975 TTAGGCACTTCAAAGAACAT 936 935
adk 1050 4873 CATCATTCTTCTCGGTGCTC 6 4967 CACTCACTTCGCTCACTTGC 620 614
metG 1102 4878 CTGAACCCCGAAAAAGATAG 31 4879 CTGTGGAAATAAACGATGTC 1050 1,019
icd 1209 4965 TTCATTACTGCCGATTATTC 66 4966 TTTGGTGTCTTTCTGCTTAC 1129 1,063
pepN 1602 5054 CACACCTCAAGCCAAATACC 9 5055 GTACAGCTTCATGCCACGTT 1219 1,210
fumC 1684 4874 TTATCAAGCACAAACTCAAC 66 4875 TCACAGGCAGCATCACATTA 1079 1,013
metE 1835 4987 TTGCTCTTGAAAAATACTGG 59 4988 GAGAAGACTTACGCGCAACA 1169 1,110
ndh 2038 4989 TTGAGGATTGTTGTTGTGAC 1 4990 GTTTTAATCATGCCGTGCAG 1242 1,241
plsX 2177 5009 ATTTAACCGTTGCACTTGAT 8 5010 GGCTGGGTACTTGTCGTTTC 980 972
purM 2380 4991 GTGAGCGGTAATAATCCATC 1 4992 GCTTCGTTGCTATTGGCGGC 1023 1,022
carA 2557 4993 CAGATGGTATTTCCGTCGGT 65 4994 AAAGTGGTCAAACAGCGGTG 1111 1,046
pyrG 2627 4995 GCGGGGTTGTATCCTCTCTA 29 4996 TATTTGGTGTTTTTATTGAA 1230 1,201
malP 12 5056 GAAACCTACTCAACAGAAAC 3 5057 CAGAGTGTGGTTGGTGTAAG 1090 1,087
pncB 105 4999 GTTTTCTCCCCACATCATTC 15 5000 TTCACACATGGCTTTTTCCG 1189 1,174
hmpA 202 5001 TGCTCACCCAAGAACACATC 2 5002 CGGACCACACAAATAGAA AT 1081 1,079
glyA 296 5003 ACACCCGCCAAAATGAACAG 110 5004 CATAGGCTTCTCTTCGTCAA 1111 1,001
fruK 446 5005 TAACGGGCAGTGTAAACCAG 47 5006 GCGGATACTTGAATTTGTTG 930 883
pntA 500 5049 AGAACAACTCGCTGGTGAAA 21 5050 ATGCCCCTACTACAATGATG 1409 1,388
sdaA 602 4976 AAGGGGAAAGTTATGCTCTC 49 4977 CATTTGCTGGTGCGCTTGAG 1308 1,259
speA 761 5058 TAATCCTCTCTGTTTTTGTG 47 5059 TGTTTTTCAGTAGCATTGGC 1214 1,167
pyrC 878 5013 TGACAACACTGACGATTACA 26 5014 TTGCGAGGTAGGCCGTAGAA 936 910
glgX 977 5060 GTCAACGCCTTTCCCATTAG 15 5061 TTCGGCAATCAGCTTTACTT 1051 1,036

*The annealing temperatures were 55–62°C for primers for gyrB and pepN and 55°C for the remaining primers.
†Location of each gene on the 2 chromosomes (large and small chromosomes) of V. cholerae isolate N16961.
‡Position of the first base of the forward primer relative to the first base of the start codon.
§Position of the first base of the reverse primer relative to the first base of the start codon.
¶Genes on the small chromosome of V. cholerae isolate N16961.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO