Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 13, Number 1—January 2007

Research

Tickborne Relapsing Fever Diagnosis Obscured by Malaria, Togo

Annika Nordstrand*, Ignas Bunikis*, Christer Larsson*, Kodjo Tsogbe†, Tom G. Schwan‡, Mikael Nilsson§, and Sven Bergström*Comments to Author 
Author affiliations: *Umeå University, Umeå, Sweden; †Association Protestante des Oeuvres Médico-Sociales et Humanitaires du Togo, Lomé, Togo; ‡National Institutes of Health, Hamilton, Montana, USA; §The Swedish Institute for Infectious Disease Control, Solna, Sweden;

Main Article

Table 1

Primers used for cloning, PCR, and DNA sequencing

PrimerSequence (5′→3′)*Reference
Br_GlpQ_3_BamHIGGCGGATCCGCTTGACCAGTTGCTCCTCCGC (16)
Br_GlpQ_5_XhoIGCCGCTCGAGGAAAAGAAAATGCAAAAATAAATAAA (16)
GlpQ ForGGTATGCTTATTGGTCTTCPresent study
GlpQ RevTTGTATCCTCTTGTAATTGPresent study
GlpQ1CAAATCACTAAGCCTTAGCGAAAGATPresent study
GlpQ2ATCTGTTGGTGCTTCTTCCCAGTPresent study
GlpQ3CAGGGAAAATTGATAATGCTTGTTGGPresent study
GlpQ4CTGCTAATGTGAAATCGACGGAATAPresent study
Nested_1_FAGAGTTTGATCCTGGCTTAG (15)
Nested_1_RCTTGCATATCCGCCTACTCA (15)
Nested_2_FGGCTTAGAACTAACGCTGGCA (15)
Nested_2_RCTGCTGGCACGTAATTAGCC (15)

*Sequences in boldface indicate restriction sites for BamH1 and XhoI.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO