Volume 13, Number 7—July 2007
Dispatch
Virus Detection and Monitoring of Viral Load in Crimean-Congo Hemorrhagic Fever Virus Patients
Table
Protocol for real-time reverse transcription–PCR
| Oligonucleotide* | Purpose, concentration in nM | Sequence and label (5′→3′) | Position (U88410)† |
|---|---|---|---|
| RWCF | Forward primer, 600 | CAAGGGGTACCAAGAAAATGAAGAAGGC | 1068–1095 |
| RWCR | Reverse primer, 600 | GCCACAGGGATTGTTCCAAAGCAGAC | 1248–1223 |
| SE01 | Broad-range probe, 100 | FAM-ATCTACATGCACCCTGCTGTGTTGACA-TAMRA | 1172–1198 |
| SE03 | Additional probe, 100 | FAM-ATTTACATGCACCCTGCCGTGCTTACA-TAMRA | 1172–1198 |
| SE0A | Additional probe, 100 | FAM-AGCTTCTTCCCCCACTTCATTGGAGT -TAMRA | 1131–1106 |
*All oligonucleotides were used in an assay with the following protocol: 25-µL reaction volume, 5-µL plasma RNA (QIAamp Viral RNA mini kit; QIAGEN, Valencia, CA, USA), 1× concentration of buffer and enzymes from the OneStep RT-PCR kit (QIAGEN), and 400 µmol dNTP, 800-ng nonacetylated bovine serum albumin (Sigma-Aldrich, Munich, Germany). The cycling parameters followed in a Roche LightCycler 1.2 (Roche, Penzberg, Germany) were as follows: 30 min at 50°C, 15 min at 95°C, 46× 15 s at 94°C, and 30 s at 59°C. Fluorescence acquisition occurred at the 59°C step, wavelength filter F1/F2 mode.
†GenBank accession number.


