Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 13, Number 9—September 2007


Anaplasma platys in Dogs, Chile

Katia Abarca*Comments to Author , Javier López†‡, Cecilia Perret*, Javier Guerrero†, Paula Godoy*, Ana Veloz*, Fernando Valiente-Echeverría*, Ursula León*, Constanza Gutjahr†, and Teresa Azócar*
Author affiliations: *Pontificia Universidad Católica de Chile, Santiago, Chile; †Faculty of Veterinary Medicine, Universidad Santo Tomás, Santiago, Chile; ‡Alcántara Veterinary Clinic, Santiago, Chile;

Main Article

Table 1

Ehrlichia/Anaplasma spp. PCR primers used in this study

Ehrlichia/Anaplasma spp. (primer type) Primer Primer sequence (5′→3′) Region Reference
Ehrlichia spp., 
A. phagocytophilum, 
E. canis, E. chaffeensis, 
Ehrlichia spp. (inner) GE2F GTTAGTGGCATACGGGTGAAT 16S rRNA (5)
A. phagocytophilum (inner) ge9f AACGGATTATTCTTTATAGCTTGCT 16S rRNA (6)
E. canis, E. chaffeensis, 
E. chaffeensis (inner) E. chaffeensis CAATTGCTTATAACCTTTTGGTTATAAATA 16S rRNA (5)
E. ewingii (inner) E. ewingii CAATTCCTAAATAGTCTCTGACTATT 16S rRNA (5)
E. equi (inner) E. equi-3-IP2 GTCGAACGGATTATTCTTTATAGCTTG 16S rRNA (5)
E. platys (inner) EHRL3-IP2 TCATCTAATAGCGATAAATC 16S rRNA (5,7)
E. platys (outer) EEgro1F GAGTTCGACGGTAAGAAGTTCA groESL (8)
A. platys (inner) SQ3F ATTAGCAAGCCTTATGGGTC groESL (9)

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO