Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 14, Number 3—March 2008

Research

Genetic Variability of West Nile Virus in US Blood Donors, 2002–2005

Andriyan Grinev*, Sylvester Daniel*, Susan Stramer†, Susan Rossmann‡, Sally Caglioti§, and Maria Rios*Comments to Author 
Author affiliations: *Food and Drug Administration, Bethesda, Maryland, USA; †American Red Cross, Gaithersburg, Maryland, USA; ‡Gulf Coast Regional Blood Center, Houston, Texas, USA; §Blood System Laboratories, Tempe, Arizona, USA;

Main Article

Table 2

Primer sets used for PCR analyses of West Nile virus and sizes of overlapping amplicons*

Set/location Amplicon size, kb Name Sequence (5′ → 3′)
1/F1–R1300 1.3 F1 AGTAGTTCGCCTGTGTGAGCTGAC
R1300 TTGGCGCATGTGTCAATGCT
2/F980–R2000 1.0 F980 CTTGGAATGAGCAACAGAGA
R2000 GTTAGGTCGTTCAATGAAGC
3/F1690–R2685 1.0 F1690 GAGACGTTAATGGAGTTTGA
R2670 CTTCACTGCTTCCCACATTTG
4/F2340–R3420 1.1 F2340 TTCGGAGGCATGTCCTGGAT
R3420 CTGATCTCCATACCATACCAACA
5/F3330–R4120 0.8 F3330 GAGAGCTGCGGACACCGTGGACC
R4120 CATAGCAGACTTGCTCCTTTCT
6/F4070–R4950 0.9 F4070 CTGTTGATGGTCGGAATAGG
R4950 CCTGGTTTCGTCTGGACGTT
7/F4810–R5650 0.85 F4810 CGCCTGGACCCATACTGG
R5650 CCATTCGTATCCAGAGTTCCA
8/F5510–R6430 0.9 F5510 AGCATTGCAGCAAGAGGTTA
R6430 TAGTGCCTGGTGATCCGAGTACAC
9/F6290–R6770 0.5 F6290 CGACCGGAGGTGGTGCTTTGATGG
R6770 CCTGGAACTTCAGCCATCCA
10/F6690–R7550 0.85 F6690 CCTCCTCATGCAGCGGAA
R7550 GAGCTTGCTCCATTCTCCCA
11/F7420–R8260 0.85 F7420 CCACACCCATCATGCAGAA
R8260 CGTTGGAGCAGCTCCATCTT
12/F8170–R9050 0.9 F8170 CATAGGACGATTCGGGTCCT
R9050 CTCTTTCCCATCATGTTGTAAATGC
13/F8920–R9810 0.9 F8920 CAGCTTTGGGTGCCATGTT
R9810 GAACCTGCTGCCAATCATACC
14/F9750–R10630 0.9 F9750 TCCTCAATGCTATGTCAAAGGT
R10630 GGTCCTCCTTCCGAGACGGT
15/F10550–R11029 0.5 F10550 TGAGTAGACGGTGCTGCCTG
R11029 GATCCTGTGTTCTCGCACCACCAG

*Internal sequencing primers were also used and their sequences are available upon request.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO