Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 14, Number 3—March 2008

Research

Chikungunya Fever in Travelers Returning to Europe from the Indian Ocean Region, 2006

Marcus Panning*1, Klaus Grywna*, Marjan Van Esbroeck†, Petra Emmerich*, and Christian Drosten*1Comments to Author 
Author affiliations: *Bernhard Nocht Institute for Tropical Medicine, Hamburg, Germany; †Prince Leopold Institute of Tropical Medicine, Antwerp, Belgium;

Main Article

Table 2

Real-time reverse transcription–PCR (RT-PCR) assay results for chikungunya virus (CHIKV)

Oligonucleotide name Purpose* Sequence and label, 5′ →3′ Position (GenBank accession no.)
ChikSI Forward primer, general CHIKV assay TGATCCCGACTCAACCATCCT 241-261 (AF369024)
ChikSII Forward primer, adapted assay for Indian Ocean strain CCGACTCAACCATCCTGGAT 246-265 (DQ443544)
ChikAsI Reverse primer, general CHIKV assay GGCAAACGCAGTGGTACTTCCT 323-302 (AF369024)
ChikAsII Reverse primer, adapted assay for Indian Ocean strain GGCAGACGCAGTGGTACTTCCT 323-302 (DQ443544)
ChikP Detection probe, CHIKV FAM-TCCGACATCATCCTCCTTGCTGGC-BHQ1 300-277 (AF369024)
ICP Detection probe, internal control DYXL-ATCGTTCGTTGAGCGATTAGCAG-BHQ2 Not applicable

*All oligonucleotides were used in the following assay: 25-µL reaction volume, 3 µL of RNA extract (Viral RNA Mini Kit, QIAGEN, Hilden, Germany), QIAGEN OneStep RT-PCR Kit, 600 nmol/L each primer, 200 nmol/L each probe. Cycling at 50°C for 30 min, 95°C for 15 min, 45 cycles each at 95°C for 15 s and 58°C for 30 s, LightCycler (Roche, Mannheim, Germany).

Main Article

1Current affiliation: University of Bonn Medical Centre, Bonn, Germany.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO