Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 14, Number 3—March 2008


Discovering and Differentiating New and Emerging Clonal Populations of Chlamydia trachomatis with a Novel Shotgun Cell Culture Harvest Assay

Naraporn Somboonna*†, Sally Mead*, Jessica Liu†, and Deborah Dean*†‡Comments to Author 
Author affiliations: *Children’s Hospital Oakland Research Institute, Oakland, California, USA; †University of California, Berkeley, California, USA; ‡University of California School of Medicine, San Francisco, California, USA;

Main Article

Table 2

PCR and sequencing primers used for determining strain types of clonal isolates from reference strains and clinical samples

Primer Sequence (5′ → 3′) Location Ref
CTompA-F GTCCCGCCAGAAAAAGATAG –60 to –41 This study
CTompA-seqF ATAGCGAGCACAAAGAGAGC –44 to –25 This study
CTompA-seqB GTAAAACGACGGCCAGT 562 to 596 This study
Plasmid-PF5 AGACTTGGTCATAATGGACTT 1022 to 1002 This study
Plasmid-seqPF5 AGACTTGGTCATAATGGACTT 1022 to 1002 This study
Plasmid-PB5 TTGTCTCGGATTTTAAAAAATGT 588 to 566 This study
FCabortus GGTATGTTTAGGCATCTAAAA 172 to 192 This study
RCabortus2 GGCCATTGTAGCACGTGTGTA 1248 to 1228 This study

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO