Volume 14, Number 3—March 2008
Research
Discovering and Differentiating New and Emerging Clonal Populations of Chlamydia trachomatis with a Novel Shotgun Cell Culture Harvest Assay
Naraporn Somboonna*†, Sally Mead*, Jessica Liu†, and Deborah Dean*†‡
Table 2
PCR and sequencing primers used for determining strain types of clonal isolates from reference strains and clinical samples
| Primer | Sequence (5′ → 3′) | Location | Ref |
|---|---|---|---|
| CTompA-F | GTCCCGCCAGAAAAAGATAG | –60 to –41 | This study |
| CTompA-seqF | ATAGCGAGCACAAAGAGAGC | –44 to –25 | This study |
| VB3 | CATCGTAGTCAATAGAGGCAT | 817 to 797 | (22) |
| MVF3 | TGTAAAACGACGGCCAGTGCCCGTGCAGCTTT | 561 to 611 | (22) |
| CTompA-B | ACGGATAGTGTTATTAACAAAGAT | 1261 to 1225 | This study |
| CTompA-seqB | GTAAAACGACGGCCAGT | 562 to 596 | This study |
| C16SrRNA-F | CAGTCGAGAATCTTTCGCAAT | 359 to 380 | This study |
| C16SrRNA-seqF | AAGGCTCTAGGGTTGTAAAGCACTTT | 419 to 444 | This study |
| C16SrRNA-B | TACTGGCCATTGTAGCACGTGTGT | 1230 to 1253 | This study |
| Plasmid-PF5 | AGACTTGGTCATAATGGACTT | 1022 to 1002 | This study |
| Plasmid-seqPF5 | AGACTTGGTCATAATGGACTT | 1022 to 1002 | This study |
| Plasmid-PB5 | TTGTCTCGGATTTTAAAAAATGT | 588 to 566 | This study |
| FCabortus | GGTATGTTTAGGCATCTAAAA | 172 to 192 | This study |
| RCabortus2 | GGCCATTGTAGCACGTGTGTA | 1248 to 1228 | This study |
