Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 15, Number 12—December 2009

Research

Landscape Epidemiology of Tularemia Outbreaks in Sweden

Kerstin Svensson, Erik Bäck, Henrik Eliasson, Lennart Berglund, Malin Granberg, Linda Karlsson, Pär Larsson, Mats Forsman, and Anders JohanssonComments to Author 
Author affiliations: Swedish Defense Research Agency, Umeå, Sweden (K. Svensson, M. Granberg, L. Karlsson, P. Larsson, M. Forsman, A. Johansson); Umeå University, Umeå (K. Svensson, A. Johansson); Örebro University Hospital, Örebro, Sweden (E. Bäck, H. Eliasson); Ljusdal Healthcare Centre, Ljusdal, Sweden (L. Berglund); Umeå University Hospital, Umeå (A. Johansson)

Main Article

Table 1

Attributes of 7 novel typing markers for Francisella tularensis subsp. holarctica*

Marker category Marker name Genomic position† Size, bp Forward primer sequence (5′ →3′) Reverse primer sequence (5′ → 3′)
INDEL Ftind39 798173-4 11 ATAATTACTATCAAATGCCCCAAC CAAGATTTACCTCAAGAAATGGAT
Ftind40 1502502-821 73 ATATGATTGCTCCAGTATTTATTTC TTGTAAGGTGATCGGAGTATTT
Ftind41 1494030-328 20 CCAAGAGCAGAGCATAATTCTAA GCCTGACRCAATGACATATTTAC

Ftind42
1849905-1850278
187
AGTAATAACGGTACGATCACAAAG
GGCTTTAGCTTACCAACASAAC
VNTR
Ft-M26
1833026-37
6‡
AATACTCGCTTCTATCTTTCTGGT
AATCTTTTGGAGAGGTTTTATTCA
SNP Ft-SNP1 927939 1 ATCCCTGTTGGGATATCCTCGACTAA ACCAAGGTAGATTTGCAGCTACA§
ACCAAGGTAGATTTGCAGCTACG§
Ft-SNP2 1044580 1 atcagacttaggtgttagatcagagtt tgaatactctacgcgataagata§
tgaatactctacgcgataagatg§

*INDEL, insertion/deletion; VNTR, variable number tandem repeat; SNP, single nucleotide polymorphism.
†GenBank accession no. AM233362.1 (complete genome of F. tularensis subsp. holarctica LVS).
‡There were two 6-bp repeats in the genome sequence of LVS.
§The 2 SNP states are in boldface, an adenosine nucleotide represent a derived state for both markers.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO