Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 12—December 2010

Letter

Molecular Detection of Bartonella alsatica in Rabbit Fleas, France

Tahar Kernif, Philippe Parola, Jean-Claude Ricci, Didier Raoult, and Jean-Marc RolainComments to Author 
Author affiliations: Author affiliations: Université de la Méditerranée, Marseille, France (T. Kernif, P. Parola, D. Raoult, J.-M. Rolain); Institut Méditerranéen du Patrimoine Cynégétique et Faunistique, Vergèze, France (J.-C. Ricci)

Main Article

Table

Oligonucleotide primers and TaqMan* fluorescent probe sequences of hsp60 and gyrB genes used for reverse transcription PCRs of Bartonella alsatica

Gene
Oligonucleotide
Sequence (5′ → 3′)
Length, bp
Amplicon size, bp
hsp60 B_alsa_hsp60_F TGCTAACGCTATGGAAAAAGTTG 23 108
B_alsa_hsp60_R CCACGATCAAACTGCATTCC 20

B_alsa_hsp60_P
6FAM-TGTCGAAGAAGCAAAAACGGCTGAAACC-TAMRA
28

gyrB B_alsa_gyrB_F CGAAGCAAAACTTCTTATTAGTAAGGT 27 126
B_alsa_gyrB_R GCAAGCTTTCCTGGCAGAG 19
B_alsa_gyrB_P 6FAM-ATAGAGGCTGCTGCGGCGCG-TAMRA 20

*Applied Biosystems, Courtaboeuf, France.
hsp60, heat shock protein 60; gyrB, DNA gyrase subunit B.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO