Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 3—March 2010

Dispatch

Influenza A Pandemic (H1N1) 2009 Virus Infection in Domestic Cat

Brett A. SponsellerComments to Author , Erin Strait, Albert Jergens, Jessie Trujillo, Karen Harmon, Leo Koster, Melinda Jenkins-Moore, Mary Killian, Sabrina Swenson, Holly Bender, Ken Waller, Kristina Miles, Tracy Pearce, Kyoung-Jin Yoon, and Peter Nara
Author affiliations: Iowa State University, Ames, Iowa, USA (B. A. Sponseller, E. Strait, A. Jergens, J. Trujillo, K. Harmon, H. Bender, K. Waller, K. Miles, T. Pearce, K.-Y. Yoon, P. Nara); US Department of Agriculture National Veterinary Services Laboratories, Ames (L. Koster, M. Jenkins-Moore, M. Killian, S. Swenson)

Main Article

Table 2

Oligonucleotide sequences for primers and probes and dye labels used in confirmatory molecular testing for pandemic (H1N1) 2009 virus, National Veterinary Services Laboratories, Ames, Iowa, USA, 2009*

M+64 TCAGGCCCCCTCAAAGCCGA M probe, BHQ, FAM
Pandemic influenza N1 differentiation assay
N1 220F CAACACCAACTTTGCTGC N1 forward primer
N1 330R GGAACCGATTCTTACACTGTTGTC N1 reverse primer
N1 232 caGtcaGtGGttTccGtGaaattaGc N1 BHQ, FAM

*Primers and probes were obtained from Integrated DNA Technologies (Coralville, IA, USA) and Biosearch Technologies, Inc. (Novato, CA, USA), respectively. M, matrix; AI, avian influenza; N, neuraminidase.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO