Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 16, Number 4—April 2010

Research

Escherichia albertii in Wild and Domestic Birds

J. Lindsay OaksComments to Author , Thomas E. Besser, Seth T. Walk, David M. Gordon, Kimberlee B. Beckmen, Kathy A. Burek, Gary J. Haldorson, Dan S. Bradway, Lindsey Ouellette, Fred R. Rurangirwa, Margaret A. Davis, Greg Dobbin, and Thomas S. Whittam1
Author affiliations: Washington State University, Pullman, Washington, USA (J.L. Oaks, T.E. Besser, G.J. Haldorson, D.S. Bradway, F.R. Rurangirwa, M.A. Davis); University of Michigan Health System, Ann Arbor, Michigan, USA (S.T. Walk); The Australian National University, Canberra, Australian Capital Territory, Australia (D.M. Gordon); Alaska Department of Fish and Game, Fairbanks, Alaska, USA (K.B. Beckmen); Alaska Veterinary Pathology Services, Eagle River, Alaska, USA (K.A. Burek); Michigan State University, East Lansing, Michigan, USA (L. Ouellette, T.S. Whittam); University of Prince Edward Island, Charlottetown, Prince Edward Island, Canada (G. Dobbin); 1Deceased.

Main Article

Table 2

Primers used for amplification and sequencing of eae gene of Escherichia albertii

Primer Sequence, 5′ → 3′ Position (GenBank accession no.) Reference
Intimin γ F CGTTGAAGTCGAGTACGCCA 1867–1887 (AF081185) (9)
Intimin γ R TTCTACACAAACCGCATAGA 2782–2803 (AF081185) (9)
EaeA-F CAAACCAAGGCCAGCATTAC 1963–1982 (AF081185) This study
EaeA-R outer CCCCAAGAGAGAGGGTTCTT 2743–2763 (AF081185) This study
EaeA-R inner ACTTGATACCCCAGACCTTCA 2703–2725 (AF081185) This study
EscD-R1 GTATCAACATCTCCCGCCA 27918–27937 (AF022236) (17)
Intimin-R2 CAGAATATTAAACAAGCGCAGTTG 3103–3126 (FJ609833) This study
EaeA F06s GTAACGGACTTTACGGCTGATA 1803–1824 (FJ609833) (10)
Intimin B101 int R TGACCATATTGCAACCA 2460–2476 (FJ609833) This study
Intimin B156 int R TGACCATATCGCAACCA 2459–2475 (FJ609822) This study

Main Article

TOP