Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 16, Number 7—July 2010

Research

Population Structure of East African Relapsing Fever Borrelia spp.

Sally J. CutlerComments to Author , E. Margarita Bonilla, and Rajbir J. Singh
Author affiliations: University of East London, London, UK

Main Article

Table 1

Primer and probe sequences used in study of East African relapsing fever Borrelia spp.*

Primer specificity Primer/probe sequence, 5′ → 3′
Flagellin forward CTAGTGGGCATAGAATTAATCGTGC
Flagellin reverse GCTTGGGATAACCCTCTAATTTGA
Flagellin probe fam-TGGTATGGGTGTTGCTGGGAAAATTACG-bhq1
First-round IGS forward GTATGTTTAGTGAGGGGGGTG
First-round IGS reverse GGATCATAGCTCAGGTGGTTAG
Second-round IGS forward AGGGGGGTGAAGTCGTAACAAG
Second-round IGS reverse GTCTGATAAACCTGAGGTCGGA

*IGS, intragenic spacer.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO