Volume 17, Number 12—December 2011
Research
Enterovirus Co-infections and Onychomadesis after Hand, Foot, and Mouth Disease, Spain, 2008
Table 1
Name | Sequence, 5′ → 3′ | Gene | Virus | Sense | Position | Use |
---|---|---|---|---|---|---|
292a | CACCNGTYTCIRCIGC | VP1 | EV | A | 2582–2597 | Seq |
7g | TGCTGCARTATATGTATGT | VP1 | EV-A | G | 2879–2897 | Amp, seq |
EV71vp1g2 | ATGTTTGTACCACCCGGAGCCCC | VP1 | EV71 | G | 2894–2916 | Amp, seq |
CA10vp1g2 | ATGTATGTGCCCCCTGGCGCCCC | VP1 | CVA10 | G | 2894–2916 | Amp, seq |
CA10_55 | GGGACGCATGTGGTGTGGGA | VP3 | CVA10 | G | 2162–2181 | Amp, seq |
CA10_11 | GCGCCGGATTGGTGGCCAAA | A2 | CVA10 | A | 3326–3345 | Amp, seq |
vp1CA10 g1 | TRCAGGCTGCAGAGACGGG | VP1 | CVA10 | G | 2567–2585 | Seq |
vp1CA10a1 | GATGGGTTAGTTGCTGTTTGCCA | VP1 | CVA10 | A | 2945–2967 | Seq |
vp1CA10a2 | GGGGGCACATACATATATTG | VP1 | CVA10 | A | 2888–2907 | Seq |
*Primer positions are relative to the CVA2-Fleetwood sequence (GenBank accession no. AY421760). VP, viral protein; EV, enterovirus; A, antigenomic; seq, sequencing; G, genomic; amp, PCR amplification; CV, coxsackievirus.
Page created: November 30, 2011
Page updated: November 30, 2011
Page reviewed: November 30, 2011
The conclusions, findings, and opinions expressed by authors contributing to this journal do not necessarily reflect the official position of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.