Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 12—December 2011

Research

Enterovirus Co-infections and Onychomadesis after Hand, Foot, and Mouth Disease, Spain, 2008

Maria A. BrachoComments to Author , Fernando González-Candelas, Ana Valero, Juan Córdoba, and Antonio Salazar
Author affiliations: Centro Superior de Investigación en Salud Pública, Valencia, Spain (M.A. Bracho); Centro de Investigación Biomédica en Red en Epidemiología y Salud Pública, Barcelona, Spain (M.A. Bracho, F. González-Candelas); Universitat de València, Valencia (F. González-Candelas); University of Edinburgh, Edinburgh, Scotland, UK (A. Valero); Hospital Universitario La Fe, Valencia (J. Córdoba); Centre Salut Pública de València, Valencia (A. Salazar)

Main Article

Table 1

Primers designed in this study used to amplify and sequence the VP1 gene region*

Name Sequence, 5′ → 3′ Gene Virus Sense Position Use
292a CACCNGTYTCIRCIGC VP1 EV A 2582–2597 Seq
7g TGCTGCARTATATGTATGT VP1 EV-A G 2879–2897 Amp, seq
EV71vp1g2 ATGTTTGTACCACCCGGAGCCCC VP1 EV71 G 2894–2916 Amp, seq
CA10vp1g2 ATGTATGTGCCCCCTGGCGCCCC VP1 CVA10 G 2894–2916 Amp, seq
CA10_55 GGGACGCATGTGGTGTGGGA VP3 CVA10 G 2162–2181 Amp, seq
CA10_11 GCGCCGGATTGGTGGCCAAA A2 CVA10 A 3326–3345 Amp, seq
vp1CA10 g1 TRCAGGCTGCAGAGACGGG VP1 CVA10 G 2567–2585 Seq
vp1CA10a1 GATGGGTTAGTTGCTGTTTGCCA VP1 CVA10 A 2945–2967 Seq
vp1CA10a2 GGGGGCACATACATATATTG VP1 CVA10 A 2888–2907 Seq

*Primer positions are relative to the CVA2-Fleetwood sequence (GenBank accession no. AY421760). VP, viral protein; EV, enterovirus; A, antigenomic; seq, sequencing; G, genomic; amp, PCR amplification; CV, coxsackievirus.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO