Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 17, Number 12—December 2011

Dispatch

Japanese Encephalitis Virus Genotype Replacement, Taiwan, 2009–2010

Yi-Ying Chen1, Yi-Chin Fan1, Wu-Chun Tu1, Rey-Yi Chang, Chen-Chang Shih, In-Houng Lu, Maw-Shien Chien, Wei-Cheng Lee, Ter-Hsin Chen, Gwong-Jen Chang, and Shyan-Song ChiouComments to Author 
Author affiliations: National Chung Hsing University, Taichung, Taiwan (Y.-Y. Chen, Y.-C. Fan, W.-C. Tu, M.-S. Chien, W.-C. Lee, T.-H. Chen, S.-S. Chiou); National Dong Hwa University, Hualien, Taiwan (R.-Y. Chang, I.-H. Lu); Mennonite Christian Hospital, Hualien (C.-C. Shih); Centers for Disease Control and Prevention, Fort Collins, Colorado, USA (G.-J. Chang)

Main Article

Table

The 3 primer pairs used in reverse transcription PCR to differentiate genotypes I and III Japanese encephalitis virus, Taiwan, 2009–2010*

Specificity/ name Sequence, 5′ → 3′ Location†
All JEV
JE1F TGTGTGAACTTCTTGGCTTAGTAT 12–35
JE1R CARCATCTGTTYTCWCCTTTTGA 559–581
GI JEV only
GIJEVF CAGTCGCGAGTTTAAACGAC 2000–2019
GIJEVR CATTCAGTTCGTCCCGCACA 2688–2707
GIII JEV only
GIIIJEVF GGATGCTTGGCAGTAACAAC 904–923
GIIIJEVR AAGTCCACATCCGTTGCC 1281–1298

*JEV, Japanese encephalitis virus; GI, genotype I; GIII, genotype III.
†According to JEV strain T1P1 complete genome (GenBank accession no. AF254453).

Main Article

1These authors contributed equally to this article.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO