Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 3—March 2011

Research

Amplification of Emerging Viruses in a Bat Colony

Jan Felix Drexler1, Victor Max Corman1, Tom Wegner, Adriana Fumie Tateno, Rodrigo Melim Zerbinati, Florian Gloza-Rausch, Antje Seebens, Marcel A. Müller, and Christian DrostenComments to Author 
Author affiliations: Author affiliations: University of Bonn Medical Centre, Bonn, Germany (J.F. Drexler, V.M. Corman, A.F. Tateno, R.M. Zerbinati, F. Gloza-Rausch, A. Seebens, M.A. Müller, C. Drosten); University of Bonn, Bonn (T. Wegner); Noctalis, Centre for Bat Protection and Information, Bad Segeberg, Germany (F. Gloza-Rausch, A. Seebens)

Main Article

Table 1

Real-time reverse transcription–PCR oligonucleotides used for RNA virus testing, Germany, 2008–2010*

Virus targeted Oligonucleotide ID Sequence, 5′ → 3′ Orientation
Coronavirus
CoV-F CGTCTGGTGATGCTACTACTGCTT +
CoV-P FAM-TGCAAATTCCGTCTTTAAT-MGBNFQ Probe
CoV-R
CATTGGCACTAACAGCCTGAAA

Astrovirus
AstVa-F GCTTGATCCWGTCTATCATACTGATG +
AstVa-P FAM-CTTTTGAGTTTGCGTATGTTCA-MGBNFQ Probe
AstVa-R CACATTTTTTCCATTCTTCTTCAAG
AstVb-F TATGTACTACTGCCTTCTGGTGAAATC +
AstVb-P YAK-CCCACCAAACTCGCGGGAATCCT-BBQ1 Probe
AstVb-R
TTATCCATCGTTGTGCTCACTTG

Adenovirus AdV-F GCGGTTGCAGCTAAGATTTGT +
AdV-P FAM-CCCGTGGACAAAGAAGACACCCAGTATG-BBQ1 Probe
AdV-R CCAGCTGGAAGCGTGTTTTAT

*ID, identification; CoV, coronavirus; AstV, atrovirus; AdV, adenovirus; FAM, 6-carboxyfluorescein; MGB, minor groove binder; NFQ, nonfluorescent quencher; YAK, Yakima yellow; BBQ, black berry quencher; +, positive; –, negative.

Main Article

1These authors contributed equally to this article.

TOP