Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 4—April 2011


Complete Sequence and Molecular Epidemiology of IncK Epidemic Plasmid Encoding blaCTX-M-14

Jennifer L. Cottell, Mark A. Webber, Nick G. Coldham, Dafydd L. Taylor, Anna M. Cerdeño-Tárraga, Heidi Hauser, Nicholas R. Thomson, Martin J. Woodward, and Laura J.V. PiddockComments to Author 
Author affiliations: Author affiliations: The University of Birmingham, Birmingham, UK (J.L. Cottell, M.A. Webber, D.L. Taylor, L.J.V. Piddock); Veterinary Laboratories Agency, New Haw, Surrey, UK (N.G. Coldham, M.J. Woodward); European Nucleotide Archive–European Bioinformatics Institute, Hinxton, UK (A.M. Cerdeño-Tárraga); The Wellcome Trust Sanger Institute, Hinxton (H. Hauser, N.R. Thomson)

Main Article

Table 2

Primers used for detecting pCT-like regions in plasmids from Escherichia coli, United Kingdom, Europe, Australia, and Asia, 2006–2009

Primer Sequence, 5′ → 3′ Target DNA sequence Size, bp pCT binding site Reference
CTX-M-G9 (F) ATGGTGACAAAGAGAGTGCAAC blaCTX-M group 9 variants 876 70259–70280 (25)
CTX-M-G9 (R) TTACAGCCCTTCGGCGATG blaCTX-M group 9 variants 876 69405–69423 (25)
ISEcp1A (F) GCAGGTCTTTTTCTGCTCC Insertion sequence ISEcp1 527 71728–71746 (27)
ISEcp1B (R) ATTTCCGGAGCACCGTTTGC Insertion sequence ISEcp1 527/1,037† 71220–71239 (27)
B3A (F) AACGGCACAATGACGCTGGC Insertion sequence IS903 887 69913–69932 (24)
IS903 (R) TGTAATCCGGCAGCGTA Insertion sequence IS903 887 69045–69061 (24)
Pseudo (R) AACATTCGGCCGTTCACAGC Region downstream of blaCTX-M-14 1,636 68644–68663 This study
traK (F) GGTACCGGCATCGCACAGAA Region upstream of ISEcp1 1,037 72238–72257 This study
Sigma (F) ACAGCGTCTTCTCGTATCCA pCT putative sigma factor 1,289 48590–48609 This study
Sigma (R) GTTCTTCCAGCTGACGTAAC pCT putative sigma factor 1,289 47320–47339 This study
pCT rci (F) AAGGTCATCTGCAGGAGT pCT shufflon recombinase 945 78364–78381 This study
pCT rci (R) GTGTGCGCAGCAACAATA pCT shufflon recombinase 945 77436–77453 This study
pilN (F) GACAGGCAGAGAACACCAGA pCT pilN outer membrane protein 627 88267–88286 This study
pilN (R) ATGCTGTTCCACCTGATGAG pCT pilN outer membrane protein 627 87659–87678 This study
nikB (F) CGTGCMTGCCGTGARCTT IncI complex nikB relaxase gene 290 33077–33094 This study
nikB (R) TCCCAGCCATCCWTCACC IncI complex nikB relaxase gene 290 33350–33367 This study
pCT008 (F) CATTGTATCTATCTTGTGGG pCT pCT008-pCT009 region 428 3665–3684 This study
pCT009 (R) GCATTCCAGAAGATGACGTT pCT pCT008-pCT009 region 428 4074–4093 This study

*pCT, IncK plasmid; CTX-M, cefotaximase-modifying; F, forward primer; R, reverse primer.
†Primer ISEcp1B can be paired with primer ISEcp1A (527 bp) or with primer traK (1,037 bp).

Main Article