Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 17, Number 8—August 2011

Research

Enterovirus 68 among Children with Severe Acute Respiratory Infection, the Philippines

Tadatsugu Imamura, Naoko Fuji, Akira Suzuki, Raita Tamaki, Mariko Saito, Rapunzel Aniceto, Hazel Galang, Lydia Sombrero, Soccoro Lupisan, and Hitoshi OshitaniComments to Author 
Author affiliations: Author affiliations: Tohoku University Graduate School of Medicine, Sendai, Japan (T. Imamura, N. Fuji, A. Suzuki, H. Oshitani); Tohoku-Research Institute for Tropical Medicine Collaborating Research Center on Emerging and Reemerging Diseases, Muntinlupa City, the Philippines (R. Tamaki, M. Saito, R. Aniceto); Eastern Visayas Regional Medical Center, Tacloban City, the Philippines (R. Aniceto); Research Institute for Tropical Medicine, Muntinlupa City (H. Galang, L. Sombrero, S. Lupisan)

Main Article

Table 1

Primers used for detection and analysis of EV68, the Phillipines*

Primer (reference) Primer sequence, 5′ → 3′ Location (location no.)†
DK001 (11) CAAGCACTTCTGTTTCCC 5′ NTR (164–168)
DK004 (12) CACGGACACCCAAAGTAGT 5′ NTR (483–501)
484 (5) GGRTCYCAYTACAGGATGT VP1 (2197–2215)
222 (5) CICCIGGIGGIAYRWACAT VP1 (2933–2951)
EV68-VP1F ACCATTTACATGCAGCAGAGG VP1 (2393–2413)
EV68-VP1R GACAAGAACTTTTTCAAATGGACAA VP1 (2683–2707)

*EV, enterovirus; NTR, nontranslated region; VP, viral protein; F, forward; R, reverse.
†Location numbers correspond to the genome of EV68 Fermon strain (GenBank accession no. AY426531).

Main Article

TOP