Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 12—December 2012

Research

Virulent Avian Infectious Bronchitis Virus, People’s Republic of China

Jinling Feng, Yanxin Hu, Zhijun Ma, Qi Yu, Jixun Zhao, Xiaodong Liu, and Guozhong ZhangComments to Author 
Author affiliations: Author affiliations: The Key Laboratory of Animal Epidemiology and Zoonosis, Ministry of Agriculture, China Agricultural University, Beijing, People’s Republic of China (J.L. Feng, Y.X. Hu, J.X. Zhao, G.Z. Zhang); Animal Husbandry and Veterinary Station of Beijing, Beijing (Z.J. Ma, Q. Yu, X.D. Liu)

Main Article

Table 1

Primers used to amplify the complete genomic sequence of avian infectious bronchitis virus YN strain, People’s Republic of China

Primer* Location, bp Upstream primer Downstream primer Length, bp
1 22–1,475 ATATCATACATACTAGCCTTG AGTTAAGTCGTTTCGCATG 1,454
2 1,302–2,411 CCAACTGGTTTTATGGGTGC TGGAAGTGTCACTGCCTCG 1,110
3 2,240–3,784 ACTTGGTAGAGTTTCTGGGG TTGACATACGAAGGTGTGACA 1,545
4 3,635–5,161 TGTAAACGCCGCAAATGAG GGCAACTTGGAATCCTCTT 1,527
5 5,040–6,636 GATCTTACTGACTTTGAAC CACTGAAACACTTAACTG 1,597
6 6,424–7,936 GGAATTGTGACGAGTATGG TGAAAGTATACCCTATGAGGA 1,513
7 7,746–9,246 GAAATTGTCGGTTACACTCAG TAGAACGCATAGTAACAGGG 1,501
8 9,130–9,985 CTAACGCTGAAACTCCA GTTGGCAATAGGAAAGTA 856
9 9,082–10,645 TCAGTAGGCGGATAAAAGG ATAGGCAACACACGGTCG 1,564
10 10,516–12,092 ATTTCAAAGTTTCGGTTGACC CACAGAAGCTCCTCCATAG 1,577
11 11,861–13,471 GTTTTACAATCTAAAGGTCAT AAGAGCGGGATCTCCTAC 1,611
12 13,270–14,908 CAACATTCTTTTCTCTACAC GATATAACGCTCCATAACT 1,639
13 14,712–16,138 CTGATTCTAAGTGTTGGGTTG TCCTTTGAGGTACTATGCGA 1,427
14 16,027–17,539 TGCTCGTGTTGTTTTTACTGC CACTTGCTCCTTGCCTATTTT 1,513
15 17,362–18,993 CCACTTGAGGGCTTTGT TAAACATACAGGTTCGCT 1,632
16 18,945–20,442 AAGCGGTATYCNTATGTAGAA ATAGTRCAVACAAAAKRGTCA 1,498
17 20,336–21,920 ACTGAACAAAAGACMGACTT CCACCAGAAACTACAACT 1,585
18 21,873–22,919 AAGGTTAATCCCTGTGAAG AGTYTCVGTAAGAATAGCA 1,047
19 22,723–23,837 CTTTTGCHACTCAGATDCA AGATTTCTTACCACACTTACT 1,115
20 23,435–24,898 ATTTGTAGAAGATGACGAT CATTGTTGACCATTAGTTA 1,464
21 24,747–26,141 GCAGCGATAATACTTACCGTG GCTTGGCGTCTCCAGTATC 1,395
22 25,965–27,650 TATCAAACTAGGAGGACCA GCTCTAACTCTAAACTAGCCT 1,686

*Primer locations are listed according to strain SC021202 (GenBank accession no. EU714029).

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO