Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 5—May 2012

Research

Characterization of Virulent West Nile Virus Kunjin Strain, Australia, 2011

Melinda J. Frost1, Jing Zhang1, Judith H. Edmonds1, Natalie A. Prow1, Xingnian Gu, Rodney Davis, Christine Hornitzky, Kathleen E. Arzey, Deborah Finlaison, Paul Hick, Andrew Read, Jody Hobson-Peters, Fiona J. May, Stephen L. Doggett, John Haniotis, Richard C. Russell, Roy A. Hall2, Alexander A. Khromykh2, and Peter D. Kirkland2Comments to Author 
Author affiliations: Elizabeth Macarthur Agriculture Institute, Menangle, New South Wales, Australia (M.J. Frost, J. Zhang, X. Gu, R. Davis, C. Hornitzky, K.E. Arzey, D. Finlaison, P. Hick, A. Read, P.D. Kirkland); The University of Queensland, St Lucia, Queensland, Australia (J.H. Edmonds, N.A Prow, J. Hobson-Peters, F.J. May, R.A. Hall, A. A. Khromykh); University of Sydney and Westmead Hospital, Westmead, New South Wales, Australia (S.L. Doggett, J. Haniotis, R.C. Russell)

Main Article

Table 1

Primers used for viral RNA amplification and genomic sequencing of WNV isolates from horses and mosquitoes, Australia, 2011*

RT-PCR region Forward primer, 5′ → 3′ (relative genome position†) Reverse primer, 5′ → 3′ (relative genome position†)
Amplification and sequencing of whole genome  
5′ NTR capsid TAGTTCGCCTGTGTGAGCTG (5′ NTR-2) TTGAAAATTCCACAGGAATGG (capsid-1772)
Capsid-NS2A GTGATAGCATTGGGCTCWCA (capsid-1720) ATCTTGAAGGYYGCCATGAG (NS2A-1760)
NS2A-NS3 CACTGATGTGTTACGCTATGTCA (NS2A-3678) CAAAGTCCCAATCATCGTTCT (NS3-5807)
NS3-NS5 CGGTTTGGTTTGTGCCTAGT (NS3-5687) CCAACTTCACGCAGGATGTA (NS5-9235)
NS5–3′ NTR GACCACTGGCTTGGAAGAAA (NS5-9169) CTGGTTGTGCAGAGCAGAAG (3′ NTR-10955)
Partial sequencing of key regions of genome  
NS3 GTGCTGGTAAAACAAGGAGG (NS3-5201) TGTATCCTCTAGCCGCGATG (NS3-5493)
NS5 TCGGCCCAGATGATGTG (NS5-9575) CGGCATGGAACCACCAGTGTTC (NS5-9860)

*Primers were designed from available sequences in GenBank to cover the coding regions of any WNV genome. WNV, West Nile virus; RT, reverse transcription; NTR, nontranslated region; NS, nonstructural protein.
†WNVNY99 GenBank accession no. NC_009942.1.

Main Article

1These authors contributed equally to the major technical aspects of this research.

2These authors served as joint senior authors.

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO