Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 18, Number 8—August 2012

Letter

Rickettsia felis in Fleas, Southern Ethiopia, 2010

Oleg Mediannikov, Alemseged Abdissa, Georges Diatta, Jean-François Trape, and Didier RaoultComments to Author 
Author affiliations: Institut de Recherche pour le Développement, Dakar, Senegal (O. Mediannikov, G. Diatta, J.-F. Trape); Jimma University, Jimma, Ethiopia (A. Abdissa); and Aix Marseille University, Faculté de Médecine, Marseille, France (D. Raoult)

Main Article

Table

Sequences of primers and probes used to identify fleas by quantitative real-time PCR, southern Ethiopia, 2010

Species Forward primer, 3′→5′ Reverse primer, 3′→5′ Fluorescent probe
P. irritans CGAATACTTTTAGAAAGCCAAAACA CATTGATGACCAATAGATTTTAGAGTG TTGCTTTACCGTCTTTACGTTT
C. felis TCGTTATTTACTTGAAAGACAAAATG TCATTGATGACCAATTGCTTT TGCTTTACCTTCTCTTCGACTTTT

*P., Pulex; C., Ctenocephalides.

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO