Skip directly to local search Skip directly to A to Z list Skip directly to navigation Skip directly to site content Skip directly to page options
CDC Home

Volume 7, Number 1—February 2001


Geographic Subdivision of the Range of the Malaria Parasite, Plasmodium vivax

Jun Li*, William E. Collins†, Robert A. Wirtz†, Dharmendar Rathore*, Altaf Lal†, and Thomas F. McCutchan*Comments to Author 
Author affiliations: *National Institutes of Health, Bethesda, Maryland, USA; †Centers for Disease Control and Prevention, Atlanta, Georgia, USA

Main Article

Figure 2

Sequences of Plasmodium vivax isolates are distinguished by variation in the 3' end of the S-type rRNA gene (10). The S-type gene is longer in Old World isolates and in P. simium. Oligonucleotide #902 (5'CAGCAAGCTGAATCGTAATTTTAA3') was used to detect type A rRNA, and #743 (5'ATCCAGATCCAATCCGACATA3') and #901 (5'GATAAGCACAAAATAGCGAAATGC3') were used to differentiate the two S-type rRNAs in membrane blot hybridization. American Type Culture Collection reference numbers not designated in the Figure

Figure 2. Sequences of Plasmodium vivax isolates are distinguished by variation in the 3' end of the S-type rRNA gene (10). The S-type gene is longer in Old World isolates and in P. simium. Oligonucleotide #902 (5'CAGCAAGCTGAATCGTAATTTTAA3') was used to detect type A rRNA, and #743 (5'ATCCAGATCCAATCCGACATA3') and #901 (5'GATAAGCACAAAATAGCGAAATGC3') were used to differentiate the two S-type rRNAs in membrane blot hybridization. American Type Culture Collection reference numbers not designated in the Figure 1 legend are as follows: Thai R112, Thai R115, Honduras-1 T09794, Honduras-2 T10595, Brazil-1 T40695, and Thai K1090. Haiti, Brazil-2, and the West African isolates came directly from the Centers for Disease Control and Prevention (CDC).*† 
*The P. vivax SAL-1 strain, Africa strain, Pakistan strain, Brazil strain, and New World monkey vivax, P. simium, were from CDC. P. vivax Vietnam strain, Chesson strain, and Panama strain were from the American Type Culture Collection. The four Thai strains were from Walter Reed Medical Center; they were collected from four geographically separate locations in Thailand and their immunologic characteristics described with regard to the circumsporozoite protein gene (9). The heparinized blood samples were stored in 5% glycerolyte at -70°C.
†Purified DNA from frozen blood samples was processed with DNAzol reagents (GIBCO-Bethesda Research Laboratory, Gaithersburg, MD) according to the manufacturer's instructions. The partial sequence of 18S rRNA genes that covers variable regions 7 and 8 was amplified with a pair of genus-conserved primers, #841 and #844 (10). The sequence of an open reading frame (ORF 470) on the 35-kb plastid-like DNA was amplified with a pair of oligonucleotide primers #1274 (5' GTAAAATTATATAAACCACC 3') and #1273 (5' GCACAATTTGAACGTAC 3') conserved in plastid-like organelle in Apicomplexa (11). The sequence of circumsporozoite protein genes was amplified with oligonucleotide primers #1157 (5'AATGGAGTAAACTTCAATAATGTA 3') and #1160 (5' CTCCACAGGTTACACTGCATG 3'). The reaction was set up in a 100-L reaction volume containing 20-50 ng DNA, 200 M of each deoxynucleoside triphosphate, 50 mM KCl, 10 mM Tris-HCl (pH8.3), 2 mM MgCl2, and 2.5 U Taq DNA polymerase (Perkin-Elmer Cetus, Norwalk, CT) at a three-step cycling with the following parameters: 94C/1 min for denaturation, 50C/1 min for annealing, and 72C/1-2 min for elongation for a total of 30 cycles. Conditions for separation of polymerase chain reaction products on agarose electrophoresis and 32P-ending labeled probe hybridization were described (8,10). Oligonucleotide #902 (5'CAGCAAGCTGAATCGTAATTTTAA3') was used to detect type-A rRNA, and #743 (5'ATCCAGATCCAATCCGACATA3') and #901 (5'GATAAGCACAAAATAGCGAAATGC3') were used to differentiate the two S-type rRNAs in membrane blot hybridization. Oligonucleotide #1163 (5'AGAGCAGCTGGACAGCCAGCA3') and #1165 (5'GCWGGCAATCAACCAGGAGCA3') were used as probes to differentiate Sal-1 (classic) and PVK247 (variant) types of circumsporozoite protein genes, respectively. The gene coding for 18S ribosomal RNA was amplified from the DNA of Thai isolates with oligonucleotides #566, 5'GGA TAA CTA CGG AAA AGC TGT AGC3', and #570, 5'CGA CTT CTC CTT CCT TTA AAA GAT AGG3', as the 5' and 3' end primers, respectively. Both primers are conserved for the genus Plasmodium and cover most of the transcribed sequences from approximately 140 downstream of the 5' end to 40 bp upstream of the 3' end.

Main Article

¹The biologic diversity inherent in P. vivax already justifies the use of a trinomial system for naming its members that includes the designation of subspecies, a taxonomic character given formal recognition in the International Rules of Zoological Nomenclature. A subspecies is a population or group of populations inhabiting a geographic subdivision of the range of a species and differing from other populations by diagnostic morphologic characteristics.

²The designation of separate species does not require that the two organisms cannot mate and produce viable progeny, only that this does not happen with frequency in natural situations.

Top of Page


Past Issues

Select a Past Issue:

Art in Science - Selections from Emerging Infectious Diseases
Now available for order

CDC 24/7 – Saving Lives, Protecting People, Saving Money. Learn More About How CDC Works For You… The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO