Skip directly to local search Skip directly to A to Z list Skip directly to navigation Skip directly to site content Skip directly to page options
CDC Home

Volume 7, Number 1—February 2001


Geographic Subdivision of the Range of the Malaria Parasite, Plasmodium vivax

Jun Li*, William E. Collins†, Robert A. Wirtz†, Dharmendar Rathore*, Altaf Lal†, and Thomas F. McCutchan*Comments to Author 
Author affiliations: *National Institutes of Health, Bethesda, Maryland, USA; †Centers for Disease Control and Prevention, Atlanta, Georgia, USA

Main Article

Figure 4

Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Figure 4. Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Main Article

¹The biologic diversity inherent in P. vivax already justifies the use of a trinomial system for naming its members that includes the designation of subspecies, a taxonomic character given formal recognition in the International Rules of Zoological Nomenclature. A subspecies is a population or group of populations inhabiting a geographic subdivision of the range of a species and differing from other populations by diagnostic morphologic characteristics.

²The designation of separate species does not require that the two organisms cannot mate and produce viable progeny, only that this does not happen with frequency in natural situations.

Top of Page


Past Issues

Select a Past Issue:

Art in Science - Selections from Emerging Infectious Diseases
Now available for order

CDC 24/7 – Saving Lives, Protecting People, Saving Money. Learn More About How CDC Works For You… The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO