Emerging Infectious Disease ISSN: 1080-6059

Geographic Subdivision of the Range of the Malaria Parasite, Plasmodium vivax

Jun Li*, William E. Collins†, Robert A. Wirtz†, Dharmendar Rathore*, Altaf Lal†, and Thomas F. McCutchan*

Author affiliations: *National Institutes of Health, Bethesda, Maryland, USA; †Centers for Disease Control and Prevention, Atlanta, Georgia, USA

Main Article

Figure 4

Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Figure 4. Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Main Article

¹The biologic diversity inherent in P. vivax already justifies the use of a trinomial system for naming its members that includes the designation of subspecies, a taxonomic character given formal recognition in the International Rules of Zoological Nomenclature. A subspecies is a population or group of populations inhabiting a geographic subdivision of the range of a species and differing from other populations by diagnostic morphologic characteristics.

²The designation of separate species does not require that the two organisms cannot mate and produce viable progeny, only that this does not happen with frequency in natural situations.

Top of Page

The opinions expressed by authors contributing to this journal do not necessarily reflect the opinions of the U.S. Department of Health and Human Services, the Public Health Service, the Centers for Disease Control and Prevention, or the authors' affiliated institutions. Use of trade names is for identification only and does not imply endorsement by any of the groups named above.