Skip directly to local search Skip directly to A to Z list Skip directly to navigation Skip directly to site content Skip directly to page options
CDC Home

Volume 7, Number 1—February 2001

Synopsis

Geographic Subdivision of the Range of the Malaria Parasite, Plasmodium vivax

Jun Li*, William E. Collins†, Robert A. Wirtz†, Dharmendar Rathore*, Altaf Lal†, and Thomas F. McCutchan*Comments to Author 
Author affiliations: *National Institutes of Health, Bethesda, Maryland, USA; †Centers for Disease Control and Prevention, Atlanta, Georgia, USA

Suggested citation for this article

Abstract

We examined geographically distinct isolates of Plasmodium vivax and categorized them according to developmental success in Anopheles albimanus. We found that parasites from Central America and Colombia form a group distinct from those of Asia. New World isolates have a distinct chromosomal translocation and an episomal variation in the open reading fram (ORF) 470 DNA sequence that distinguishes them from the other isolates tested. Old World types of P. vivax were introduced into the Americas, and a remnant of this lineage remains in P. simium. It is indistinguishable from Old World P. vivax to the extent determinable by using our encoded markers and the examination of its developmental pattern in mosquitoes. The cohesive characteristics that separate types of P. vivax are predictors of range and potential for transmission and hence require taxonomic distinction.

Plasmodium vivax is the most common of four human malaria species, with a worldwide distribution within approximately 16 to 20 north and south of the summer isotherms. Before its unexplained disappearance from Europe, P. vivax was probably present as far north as Moscow. Currently the organism is endemic in many countries of Asia, the South Pacific, North Africa, the Middle East, and South and Central America (1).

The biologic diversity included within this species designation has justified the use of a trinomial system for naming, including the subspecies, a taxonomic character given formal recognition in the International Rules of Zoological Nomenclature. The concepts of "species" and "subspecies" are still hotly debated, camps often dividing between those referred to as lumpers and splitters. Although species has various definitions, most depend on whether populations share or do not share a common gene pool. A subspecies is a population or group of populations inhabiting a geographic subdivision of the range of a species and differing from other populations by diagnostic morphologic characteristics. It follows that subspecies cannot be sympatric, as interbreeding would lead to the loss of identity (2). Some researchers think that distribution can be either geographically or ecologically based (3).

In this study, we describe a large number of New and Old World P. vivax isolates. To assess a measure of relationship between 10 different parasite isolates, we measured the parasite infectivity of >25,000 mosquitoes in a 10-year period, using a ratio of infectivity of Anopheles albimanus to that of an internal control as a measure of success. We also identified and monitored a genomic and an organellar polymorphic marker and applied these to 17 different isolates from a wide geographic range. Our results were totally consistent with the geographic separation based on developmental differences in the mosquito. We determined that independently isolated strains of New World P. vivax are very similar to each other and, as a group, distinguish themselves from a broad distribution of isolates collected in Asia and Oceania. This is the first report of genomic, organellar, and phenotypic markers coalescing along geographic boundaries and justifies the naming of a new subspecies of P. vivax.

Geographic Differences in Development of P. vivax Isolates

Figure 1

Thumbnail of Comparison of the relative developmental success of 11 different isolates of Plasmodium vivax in Anopheles albimanus and An. freeborni. The black bars and arrows represent An. albimanus, and the grey bars and arrow represent An. freeborni. The origin of each isolate is indicated on the map. American Type Culture collection reference numbers are as follows: N. Korea T1206, Thai K1294, Vietnam C30151, New Guinea C30060, Nicaragua 30073, Panama C30138, and El Salvador-1 C30197. W. Paki

Figure 1. Comparison of the relative developmental success of 11 different isolates of Plasmodium vivax in Anopheles albimanus and An. freeborni. The black bars and arrows represent An. albimanus, and the grey bars...

We examined the transmissibility of different isolates of P. vivax and found that they vary in a selective way. The comparative feeding results from the study of 10 individual strains of P. vivax are shown (Figure 1). For all parasite strains collected from the New World infected mosquitoes (as measured by oocyst count), the average infection rate was 30.6% for a single line of Central American An. albimanus and 51.9% for a laboratory line of An. freeborni, the positive control. The Old World parasite strains, on the other hand, had an average infection rate of only 0.25% for An. albimanus, while infecting the positive control, An. Freeborni, quite normally at 63.4%. Methods and preliminary data on the correlation between different mosquito colonies and parasite development in An. culicifacies have been reported (5).

Further experiments tested the effect of the origin of An. albimanus on transmissibility of P. vivax. Five New World An. albimanus colonies were far more susceptible to each New World parasite than to any Old World parasite line (Table). The average infection rate for five different New World colonies was 21.2%. As the positive control, An. freeborni was infected by parasites from the different areas with a mean infection rate of 57.1%. Hence, the distinction of developmental success in An. albimanus did not relate to characteristics of a single colony but was a more general phenomenon. The single exception to the Old World-New World separation was P. simium, a New World monkey parasite morphologically similar to P. vivax, which has been reported to successfully infect An. freeborni but not to be very infective to An. albimanus (6).

Separation of New and Old World P. vivax Malaria Indicated by Analysis of Nuclear-Encoded and Plastid DNA Markers

P. vivax isolates representing different geographic areas and one isolate of P. simium, a parasite of New World monkeys, were characterized according to sequence polymorphisms within the nuclear-encoded rRNA genes and the 35-kb plastid genome. The New World P. vivax isolates were identical under these criteria, while the Old World P. vivax and P. simium also formed a distinct and related group. These parasites include most of the original parasite lines tested for developmental success in An. albimanus.

Consistent Differences Between Old and New World Isolates of P. vivax in S-type rRNA Genes: Result of a Single-Type Gene Conversion

Figure 2

Thumbnail of Sequences of Plasmodium vivax isolates are distinguished by variation in the 3' end of the S-type rRNA gene (10). The S-type gene is longer in Old World isolates and in P. simium. Oligonucleotide #902 (5'CAGCAAGCTGAATCGTAATTTTAA3') was used to detect type A rRNA, and #743 (5'ATCCAGATCCAATCCGACATA3') and #901 (5'GATAAGCACAAAATAGCGAAATGC3') were used to differentiate the two S-type rRNAs in membrane blot hybridization. American Type Culture Collection reference numbers not designated

Figure 2. Sequences of Plasmodium vivax isolates are distinguished by variation in the 3' end of the S-type rRNA gene (10). The S-type gene is longer in Old World isolates and...

DNA sequence analysis of the cloned 18S rRNA genes from 17 isolates, including 5 of 7 Old World isolates and 5 of 7 New World isolates from infectivity studies, indicated that all strains shared similar sequence types, including 3 types of genomic rRNA genes as we described for the Sal-1 strain (7,8). In comparing the 18S rRNA sequences of New World and Old World isolates, however, we found a consistent polymorphism that separated the two according to geographic location (Figure 2). While the genes expressed in blood stage (A type) and oocysts (O type) remained the same in all isolates, the S-type genes transcribed in sporozoites were maintained in either one or the other of two distinct forms (Figure 2). The New World type of S gene has been reported in a P. vivax isolate from El Salvador (12), and the Old World type has been reported to exist in the monkey malaria, P. simium (13; Li and McCutchan, unpub. data). The difference between the two types of S gene is localized at the 3' end of the gene, including the last variable region, V8 (10). The A gene and two types of the S genes were differentiated on the basis of fragment length (Figure 2). The assignment of type was confirmed in all isolates by DNA sequence analysis. The results indicate that one type of S gene is shared by all strains or isolates from Central and South America. Parasites from Asia, the Pacific region, and Africa have a genotype similar to the S gene from the primate malaria P. cynomolgi and exactly like that of P. simium.

Figure 3

Thumbnail of The sequence of Plasmodium vivax from the Americas is distinguished from Old World isolates by analysis of the 3' end of the S-type rRNA gene. The S-type rRNA sequences were determined from cloned amplified products of parasite DNA and RNA.

Figure 3. The sequence of Plasmodium vivax from the Americas is distinguished from Old World isolates by analysis of the 3' end of the S-type rRNA gene. The S-type rRNA sequences were determined...

The structure of the variant New World S gene appeared to be the result of a simple conversion between the A and S genes (Figure 3). Further, the point of conversion between A and S genes appeared to be the same (within 9 bp) in all New World isolates. The simplest conclusion is that only one conversion occurred, and it existed in the progenitor of all New World strains thus far examined. Expression of the two types of S gene has been confirmed by sequencing of cloned reverse transcriptase/polymerase chain reaction fragments amplified from sporozoite rRNA (Li and McCutchan, data not shown).

Analysis of the Open Reading Frame (ORF) 470 in P. vivax Consistent with Parasite Associations Established with Genomic Markers

Figure 4

Thumbnail of Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273 (5'GCACAATTTGAACGTAC3') (11).

Figure 4. Polymorphism in the ORF 470 region of the 35-kb plastid-like DNA was determined by DNA sequence analysis after amplification of DNA from each isolate with oligonucleotide primers #1274 (5'GTAAAATTATATAAACCACC3') and #1273...

This 35-kb circular DNA is maternally inherited and highly conserved in sequence (14). We investigated the ORF 470, the small subunit rRNA, and the Clp gene for phylogenetically informative sites. The results show that a conserved substitution of the ORF 470 has been maintained among the New World P. vivax, where an isoleucine is replaced by valine. The parasites from Old World isolates maintain the isoleucine, as do their putative progenitors from primate malarias (Figure 4). The limited number of maternal types is not unexpected because of the extensive plastid homogeneity found within species of these parasites (14). We assume that this polymorphism is representative of two separate lineages.

Discussion

The evolution of a new species or subspecies from within the range of a single sexually reproducing population has been of central interest to biologists since before Darwin. With regard to medicine and epidemiology, an understanding of the above would substantially contribute to designing procedures for pathogen control (15). We have shown that a partition subdivides the population range of P. vivax and have presented one reason why such partitions remain stably in place.

The epidemiologic impact of barriers to genetic exchange is substantial. Such barriers can come from both geologic and biologic sources. We have shown that differing vector-parasite compatibility can create genetic isolation between populations of a single parasite species. In principle, the question of differing vector-parasite compatibility has been addressed by the observation of historic events. When millions of potentially exposed soldiers returned home from World War II, Korea, and Vietnam, reintroduction of malaria was considered a serious possibility, given that P. vivax was only eliminated from the United States in the 1940s and the vectors were still in abundance. The fact that P. vivax was not reintroduced was, at the time, surprising. How could the parasites from Asia and America be different? Because P. vivax collected from the New World, Africa, and Asia have indistinguishable morphologic features and life cycles, as well as many of the same surface antigens, it was assumed that they represented the same parasite.

A dichotomy is revealed when one compares the relative developmental success of different parasite isolates in An. albimanus and An. freeborni. Both mosquitoes come from the Americas, but An. albimanus is indigenous to malarious areas and An. freeborni is not. When different isolates of P. vivax were fed to the New World mosquitoes, an obvious division formed along broad geographic lines. An. albimanus were more easily infected by New World parasites than by Old World parasites, whereas no difference in infectivity was detected in the control, An. freeborni. Hence, adaptation to the mosquito, rather than general developmental fitness, is the selective basis for separation. Examination of An. albimanus from five different areas of the New World each revealed the dichotomy. It is of interest that the insect-parasite association developed along broad geographic lines.

More than 25,000 mosquitoes were dissected during a 10-year period, and the resultant large numbers have implications for the interpretation of results. Clearly, the feedings were repeated many times, and each can be considered a separate experiment. The same protocol was followed in each experiment, but slight variations in factors such as the exact age of the mosquitoes and the source of infective blood must have occurred during the study period. The simple conclusion that a large difference exists in the developmental success of parasites from the Old and New Worlds in An. albimanus was entirely consistent over the period, and all experiments are in accord with that conclusion. Development of the same parasite strains was also tested in an Old World mosquito, An. culicifacies (Collins et al., unpub. data). As a group, Old World parasites infected An. culicifacies more efficiently and had a higher rate of oocyst production than parasites from the New World, although some New World parasite lines had not lost the potential to infect An. culicifacies. This indicates that while the lineage giving rise to New World parasites may have developed successfully in An. culicifacies and other Old World mosquitoes, that potential may be lost during the process of adapting to a new environment.

The developmental mechanism involved in determining success of a parasite isolate in mosquito colonies represents an unknown number of loci. Data supporting the division defined by infectivity studies were based on DNA polymorphisms in samples supplied from the American Type Culture Collection (Rockville, MD) and the Centers for Disease Control and Prevention's Parasitology Branch. The episomal marker is located within the ORF 470 of the 35-kb plastid (11), which is physically unlinked to genomic markers. Our genomic marker is a polymorphism resulting from a defined ribosomal RNA gene transformation. Although we cannot definitively say that the division of groups is related to their genetic isolation (i.e., we cannot show that we have saturated the genome with markers), that does appear to be the case. The premise of our interpretation is that episomal and chromosomal ribosomal markers are not linked to each other and are unlikely to be linked to genes controlling parasite development in the mosquito.

P. simium carries genomic and maternal polymorphisms identical to the Old World human parasite P. vivax. Its ancestors are certainly more maternally related to the Old World P. vivax of humans than to the P. vivax that now dominates humans in South America. Thus, a lateral transfer occurred during P. simium evolution, as previously indicated (13,16,17). P. simium and New World P. vivax did not originate directly from the same source, contrary to published speculation on the parasite's evolution. Therefore, P. vivax most likely entered the New World on two separate occasions and from different geographic locations.

Two types of repetitive epitope have been described in the circumsporozoite protein gene of P. vivax; their distribution appears to be worldwide (18). We confirm this finding in our isolates (data not shown); hence, all our isolates arose from a common ancestor. The separation of these two P. vivax subspecies may have started before entry into the Americas, but it is likely that isolation and adaptation to the new environment were strong forces in driving the fixation of the parasites that now exist there. It is widely, although not universally, agreed that P. vivax entered into the Americas within the last 500 years. If true, this would suggest that fixation and dispersal over a wide geographic area happened within a few hundred years. Although this seems rapid, it is within the realm of what we know about malaria. The period of isolation needed for subspecific differentiation can occur in less than 300 generations. In a natural system involving Plasmodium, this could happen in as few as 60 years (19). Speculation with regard to the evolution of malaria parasites of neotropical monkeys suggests that altered selective pressures on an isolated group of mammalian malaria parasites may lead to the evolution of a new species in only a few hundred years. The time of genetic separation needed to form new species is thus generously provided within the above range.

P. vivax of the New World clearly has distinctive features that relate to its potential for spread and thus require taxonomic distinction. Justifications for the designation of subspecies are met (1); phenotypic differences exist among parasites that occupy different sectors of the inclusive geographic range of P. vivax. There are subspecies of Old World P. vivax separated on the basis of biologic characteristics: relapse pattern (e.g., P. vivax hibernans and P. vivax multinucleatum), and morphologic characteristics such as multiple-cell invasion (20). It follows that if these were sympatric, interbreeding would have led to the loss of identity (2). The question is whether species classification is justified for the New World parasite. Historically, a major branching occurred in the P. vivax species, or species complex, which divided the New World P. vivax from known Old World parasites. The problem with either designation (species (2) or subspecies) is that it is unclear how many other taxonomic distinctions are warranted within the New World. For example, a study in Mexico links a polymorphism within the circumsporozoite protein gene with transmission and geographic distribution (21). Although this does not indicate the existence of other restricted gene pools, the circumsporozoite protein gene and transmission being genetically associated, it does show that further subdivisions are present within the New World that are being affected by mosquito distribution. We suggest that the New World parasite be given a subspecies designation, P. vivax collins, until it can be determined whether the New World group can be further subdivided into phenotypically defined groups occupying portions of this parasite's range. The species designation P. collinsi should then be considered.

Acknowledgments

We thank Margery Sullivan for help in designing the figures and critically reading the manuscript and Nancy Shulman for editorial advice and assistance.

Dr. Li was a senior postdoctoral fellow in the Laboratory of Parasitic Diseases at the National Institutes of Health during the course of this work. He is now in his second-year residency in pathology at New York University. Upon completion of his residency, he plans to continue his research efforts in infectious diseases.

References

  1. Bruce-Chwatt LJ. Essential malariology. New York: John Wiley and Sons; 1985.
  2. Mayr E. Animal species and evolution. Cambridge: Belknap Press of Harvard University Press; 1963.
  3. Killick-Kendrick R. In: Peters W, editor. Rodent malaria. London: Academic Press; 1978.
  4. Collins WE, Skinner JC, Pappaioanou M, Ma NS, Broderson JR, Sutton BB, Infection of Aotus vociferans (karyotype V) monkeys with different strains of Plasmodium vivax. J Parasitol. 1987;73:53640. DOIPubMed
  5. Collins WE, Warren M, Huong AY, Skinner JC, Sutton BB, Stanfill PS. Studies of comparative infectivity of fifteen strains of Plasmodium vivax to laboratory-reared anopheline mosquitoes, with special reference to Anopheles culicifacies. J Parasitol. 1986;72:5214. DOIPubMed
  6. Collins WE, McClure H, Strobert E, Skinner JC, Richardson BB, Roberts, et al. Experimental infection of Anopheles gambiae s.s., Anopheles freeborni, and Anopheles stephensi with Plasmodium malariae and Plasmodium brasilianum. J Am Mosq Control Assoc. 1993;9:6871.PubMed
  7. Li J, Wirtz RA, McCutchan TF. Analysis of malaria parasite RNA from decade-old giemsa-stained blood smears and dried mosquitoes. Am J Trop Med Hyg. 1997;57:72731.PubMed
  8. Li J, Wirtz RA, McConkey GA, Sattabongkot J, McCutchan TF. Transition of Plasmodium vivax ribosome types corresponds to sporozoite differentiation in the mosquito. Mol Biochem Parasitol. 1994;65:2839. DOIPubMed
  9. Wirtz RA, Burkot TR, Andre RG, Rosenberg R, Collins WE, Roberts DR. Identification of Plasmodium vivax sporozoites in mosquitoes using an enzyme-linked immunosorbent assay. Am J Trop Med Hyg. 1985;34:104854.PubMed
  10. Li J, Wirtz RA, McConkey GA, Sattabongkot J, Waters AP, Rogers MJ, Plasmodium: genus-conserved primers for species identification and quantitation. Exp Parasitol. 1995;81:18290. DOIPubMed
  11. Wilson RJM, Denny PW, Preiser PR, Rangachari K, Roberts K, Roy A, Complete gene map of the plastid-like DNA of the malaria parasite Plasmodium falciparum. J Mol Biol. 1996;261:15572. DOIPubMed
  12. Waters AP, McCutchan TF. Partial sequence of the asexually expressed SU rRNA gene of Plasmodium vivax [published erratum appears in Nucleic Acids Res 1989 May 11;17:3630-1]. Nucleic Acids Res. 1989;17:2135. DOIPubMed
  13. Escalante A, Barrio E, Ayala FJ. Evolutionary origin of human and primate malarias: evidence from the circumsporozoite protein gene. Mol Biol Evol. 1995;12:61626.PubMed
  14. Vaidya AB, Morrisey J, Plowe CV, Kaslow DC, Wellems TE. Unidirectional dominance of cytoplasmic inheritance in two genetic crosses of Plasmodium falciparum. Mol Cell Biol. 1993;13:734957.PubMed
  15. Gupta S, Ferguson N, Anderson R. Chaos, persistence and evolution of strain structure in antigenically diverse infectious agents. Science. 1998;280:9125. DOIPubMed
  16. Lal AA, de la Cruz VF, Collins WE, Campbell GH, Procell PM, McCutchan TF. Circumsporozoite protein gene from Plasmodium brasilianum. Animal reservoirs for human malaria parasites? J Biol Chem. 1988;263:54958.PubMed
  17. Escalante AA, Freeland DE, Collins WE, Lal AA. The evolution of primate malaria parasites based on the gene encoding cytochrome-b from the linear mitochondrial genome. Proc Natl Acad Sci U S A. 1998;95:81249. DOIPubMed
  18. Kain KC, Brown AE, Webster HK, Wirtz A, Keystone JS, Rodriguez MH, Circumsporozoite genotyping of global isolates of Plasmodium vivax from dried blood specimens. J Clin Microbiol. 1992;30:18636.PubMed
  19. Simpson GC. Tempo and mode in evolution. New York: Columbia University Press; 1944.
  20. Coatney GR, Collins WE, Warren M, Contacos PG. The primate malarias. Bethesda: Dept of Health, Education and Welfare (US); 1971.
  21. Gonzalez-Ceron L, Rodriquez MH, Nettel JC, Villarreal C, Kain KC, Hernandez JE. Differential susceptibilities of Anopheles albimanus and An. pseudopunctipennis to infections with coindigenous Plasmodium vivax variants VK210 and VK247 in southern Mexico. Infect Immun. 1999;67:4102.PubMed

Figures

Table

Suggested citation for this article: Jun Li, William E. Collins, Robert A. Wirtz, Dharmendar Rathore, Altaf Lal, and Thomas F. McCutchan. Geographic Subdivision of the Range of the Malaria Parasite, Plasmodium vivax. Emerg Infect Dis [serial on the Internet]. 2001 Jan [date cited] http://wwwnc.cdc.gov/eid/article/7/1/70-0035.htm

DOI: 10.3201/eid0701.700035

¹The biologic diversity inherent in P. vivax already justifies the use of a trinomial system for naming its members that includes the designation of subspecies, a taxonomic character given formal recognition in the International Rules of Zoological Nomenclature. A subspecies is a population or group of populations inhabiting a geographic subdivision of the range of a species and differing from other populations by diagnostic morphologic characteristics.

²The designation of separate species does not require that the two organisms cannot mate and produce viable progeny, only that this does not happen with frequency in natural situations.

Top of Page

Table of Contents – Volume 7, Number 1—February 2001

Comments to the Authors

Please use the form below to submit correspondence to the authors or contact them at the following address:

Thomas F. McCutchan, NIAID, National Institutes of Health, 4 Center Drive, Room 4/126, Bethesda, Maryland 20892, USA; fax: 301-402-0079





characters(s) remaining.

Comment submitted successfully, thank you for your feedback.

Comments to the EID Editors

Please contact the EID Editors via our Contact Form.

 

Past Issues

Select a Past Issue:

SARS 10th Anniversary logo

podcast icon


Lessons from the History of Quarantine, from Plague to Influenza A

Listen now or download MP3

Length: 23:11



CDC 24/7 – Saving Lives, Protecting People, Saving Money. Learn More About How CDC Works For You…

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO