Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 8, Number 3—March 2002


Eastern Equine Encephalomyelitis Virus Infection in a Horse from California

Robert P. Franklin*Comments to Author , Hailu Kinde†, Michele T. Jay‡, Laura D. Kramer†, Emily-Gene N. Green†, Robert E. Chiles†, Eileen Ostlund§, Stan Husted‡, Jonathan Smith¶, and Michael D. Parker¶
Author affiliations: *Humphrey, Giacopuzzi & Associates Equine Hospital, Somis, California, USA †University of California Davis, Davis, California, USA; ‡California Department of Health Services, Sacramento, California, USA; §National Veterinary Service Laboratory, Ames, Iowa, USA; ¶U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, Maryland, USA;

Main Article

Table 1

Reverse transcriptase-polymerase chain reaction (RT-PCR) primers used to sequence Eastern equine encephalomyelitis virus RNA

Title Sense Primer Use Region
10470 Forward 5´- ATGCCAAACTCATCATAGGTCCACT –3´ Sequencing E1
10938 Forward 5´- GTATAGCCACCGTTGCCTACAAATC –3´ Sequencing E1
11345 Forward 5´- CAGGCAGTGTATAAGGCTGTCTTAC –3´ Sequencing E1
T3 Forward 5´- AATTAACCCTCACTAAAGGGA –3´ Sequencing NSP3

Main Article

Top of Page The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO