Skip directly to search Skip directly to A to Z list Skip directly to site content
CDC Home

Volume 11, Number 1—January 2005

Research

Mycobacterium haemophilum and Lymphadenitis in Children

Lesla E.S. Bruijnesteijn van Coppenraet*, Edward J. Kuijper*Comments to Author , Jerome A. Lindeboom†, Jan M. Prins†, and Eric C. J. Claas*
Author affiliations: *Leiden University Medical Center, Leiden, the Netherlands; †Academic Medical Centre, Amsterdam, the Netherlands

Main Article

Table 1

Sequences of oligonucleotides used in this study

Primer/probe sequence (5′–3′) target sequence
ITS forward primer real-time PCR GGGGTGTGGTGTTTGAG Partial ITS
ITS reverse primer real-time PCR CTCCCACGTCCTTCATC Partial ITS
Forward primer Ec16S.1390p* TTGTACACACCGCCCGTCA Total ITS
Reverse primer Mb23S.44n* TCTCGATGCCAAGGCATCCACC Total ITS
16S forward primer P1† TAACACATGCAAGTCGAACG 16S
16S reverse primer P4† TCGTTGCGGGACTTAACCCAAC 16S
Mycobacterium genus–specific TaqMan probe Fam-GGATAGTGGTTGCGAGCATC-Tamra ITS
M. haemophilum–specific MGB-probe VIC–ACGCCACCATTACT-MGB ITS

*Primers published in (19).
†Primers published in (23).

Main Article

Top of Page

USA.gov: The U.S. Government's Official Web PortalDepartment of Health and Human Services
Centers for Disease Control and Prevention   1600 Clifton Rd. Atlanta, GA 30333, USA
800-CDC-INFO (800-232-4636) TTY: (888) 232-6348 - Contact CDC–INFO