Skip directly to search Skip directly to A to Z list Skip directly to page options Skip directly to site content

Volume 11, Number 3—March 2005

Research

Rapid Identification of Emerging Pathogens: Coronavirus

Rangarajan Sampath*Comments to Author , Steven A. Hofstadler*, Lawrence B. Blyn*, Mark W. Eshoo*, Thomas A. Hall*, Christian Massire*, Harold M. Levene*, James C. Hannis*, Patina M. Harrell*, Benjamin Neuman†, Michael J. Buchmeier†, Yun Jiang*, Raymond Ranken*, Jared J. Drader*, Vivek Samant*, Richard H. Griffey*, John A. McNeil*, Stanley T. Crooke*, and David J. Ecker*
Author affiliations: *Ibis Therapeutics, Carlsbad, California, USA; †The Scripps Research Institute, La Jolla, California, USA

Main Article

Table 2

PCR primer pairs used in this study*

Primer name Gene name Product name Genome coordinates Orientation Product
length (bp) Sequence (5′ to >3′)
RdRp primer ORF 1b Nsp12-pp1ab (RdRp) 15146–15164 Sense 88 TAAGTTTTATGGCGGCTGG
15213–15233 Antisense TTTAGGATAGTCCCAACCCAT
Nsp14 primer ORF 1b Nsp14-pp1ab (nuclease ExoN homolog) 19113–19138 Sense 137 TGTTTGTTTTGGAATTGTAATGTTGA
19225–19249 Antisense TGGAATGCATGCTTATTAACATACA

*All coordinates are based on SARS TOR2 genome (GenBank accession no. NC_004718.3). 5′ propynyl-modified pyrimidine nucleotides are shown in bold. Each primer was designed to include a thymidine (T) nucleotide on the 5′ end to minimize addition of nontemplated adenosine (A) during polymerase chain reaction (PCR) (data not shown). RdRp, RNA-dependent RNA polymerase.

Main Article

TOP